Detection of Early HIV-1 Infection among Febrile Persons and Blood Donors in Oyo State, Nigeria

Babatunde A. Olusola, David O. Olaleye, Georgina N. Odaibo
doi: https://doi.org/10.1101/2020.04.09.20058966

Abstract

About 37.9 million persons are infected with HIV globally resulting in 770,000 deaths. Over 50% of this infection and deaths occur in Sub-Saharan Africa with countries like Nigeria greatly affected. The country also has one of the highest rate of new infections globally. Diverse HIV-1 subtypes have been identified in the country. Febrile persons and blood donors pose a great transmission risk in the country especially during the early stages of infection. HIV-1 rapid kits are routinely used for diagnosis among the general population and high risk groups. However, there is limited information on the usefulness of HIV rapid kits for early detection especially in areas where diverse HIV-1 subtypes circulate. In this study, the prevalence of early HIV-1 infection as well as circulating HIV-1 subtypes among febrile persons and blood donors were determined. Furthermore, the sensitivity of a widely used HIV-1 rapid antibody kit was compared with those of Antigen/Antibody ELISA based methods. Participants were recruited from selected hospitals in Ibadan and Saki, Nigeria. The prevalence of early HIV infection among 1028 febrile persons (Ibadan: 2.22%; Saki: 1.36%) and blood donors (5.07%) studied were significantly different (P<0.03674). CRF02_AG was the predominant subtype detected with more diverse HIV-1 subtypes observed among febrile persons compared to blood donors. About 1.2% of the samples detected on Antibody based ELISA methods were undetectable on the HIV-1 rapid antibody kit. Genetic diversity of HIV-1 strains among infected individuals in Oyo State, Nigeria is still relatively high. This diversity is likely impacting on diagnosis.

Introduction

As at 2018, about 37.9 million persons are infected with HIV globally with 21% of these people not aware of their status1. This rate of infection resulted in 770,000 deaths. Also, in the same year, 1.7 million (4.4%) individuals became newly infected with the virus. Over 50% of HIV infection and AIDS-related deaths occur in Sub-Saharan Africa making the region the highest hit with the infection1. Apart from several HIV-1 subtypes and recombinant forms circulating in Africa, more than a few high risk groups are also present in the continent1,2. Although HIV prevalence is controlled in the general population in most countries in Africa, there is still high prevalence of the virus among high risk groups. To control the HIV epidemic and achieve the 95-95-95 target, it is important that new HIV infections are quickly diagnosed and high risk groups are continuously identified and monitored3. Furthermore, it is pertinent that circulating subtypes within these groups are determined. Previous studies have showed that HIV-1 subtypes have differing impacts on diagnosis, transmission, pathogenesis and vaccine designs2,4,5.

In Nigeria, over 1.9 million people are infected with HIV and around 33% of these people don’t know their status. Although there is reduction in the prevalence of HIV infection, the country still has one of the highest number of new HIV infections (130,000) and AIDS-related deaths (53,000) globally1. Diverse HIV-1 subtypes and recombinant forms (CRF02_AG, G, A, B, C, D, CRF06_cpx, URFs etc.) have been characterized in the country previously6. Several HIV-1 high risk groups such as commercial sex workers7,8, voluntary blood donors9,10, long distance drivers11–13, mammy markets contiguous to military facilities14 etc. have also been identified. We as well as other authors have previously identified persons with febrile symptoms as a group to be screened for early HIV infection15–17. Most of these individuals are unaware of their status, hence, they pose an even higher transmission risk. The same applies to voluntary blood donors. Most blood screening centers in the country use HIV-1 Rapid antibody kits for pre-donation diagnosis. These kits miss out on infected persons at the early stages of infection. In order to sustain the gains of HIV control in the country, there is the need to diagnose persons at the early stages of HIV-1 infection as well as monitor high risk groups such as voluntary blood donors. Voluntary blood donors may fuel the spread of the virus as there is still high prevalence of unscreened or improperly screened HIV infected blood in Nigeria and other developing countries18,19.

Despite concerted efforts in the country to control HIV infection, an appreciable number of persons do not know their status and there is very limited data on circulating HIV-1 subtypes among febrile persons and voluntary blood donors. Although opportunities for HIV-1 testing have improved in the country, most testing centers use HIV-1 Rapid Antibody kits for diagnosis. These kits increase access by reducing turnaround time. However, their usefulness in eliminating samples with HIV-1 antibodies during early HIV infection diagnosis is not known. It is uncertain whether these kits’ sensitivities are not reduced in areas with high HIV-1 prevalence and diverse HIV-1 subtypes. Therefore, the aim of this study was to determine the prevalence and circulating subtypes of early HIV-1 infection among voluntary blood donors and febrile persons referred by clinicians for malaria antigen testing in hospitals in Ibadan and Saki, Oyo State, Nigeria. The performance characteristics of an HIV Rapid Antibody Point of Care test kit (Alere™ Determine™ HIV-1/2 set) for HIV-1 antibody detection was also determined.

Materials and Methods

Study sites and patient population

This study was conducted in two major cities in Oyo state, namely Ibadan and Saki as previously described15. Ibadan is the capital city of Oyo State and one of the most populated cities in Africa while Saki is a town 100 miles west of Ibadan, toward the border with the republic of Benin. Multiple HIV-1 subtypes and circulating recombinant forms (CRFs) have been shown previously to be circulating in these two cities20. Government, missionary and private owned hospitals in these cities were selected based on accessibility and availability of resident Physicians and laboratory staff. The Government hospitals were primary and secondary health care centers and services at these hospitals for outpatients were provided almost at little or no costs. Voluntary blood donors as well as persons referred by clinicians for malaria antigen test from selected hospitals in Ibadan and Saki were recruited for the study.

Recruitment of participants, sample collection and processing

Participants were recruited for this study after obtaining informed consent. Data on patient age, gender and contact details were collected. They were given feedback on their results within a week of sample collection. Individuals infected with HIV were counseled and integrated into existing HIV point of care centers. We screened 1028 participants for this study out of which 890 were referred by Physicians to on-site laboratories for malaria antigen test. This study was a continuation of an initial study started in 2015. Initial findings from the study have been previously reported15. Five milliliters of whole blood were collected in EDTA bottles from participants. Plasma was separated from the samples immediately after collection, stored at −20°C and transported in cold chain to a central laboratory for analysis. The samples were then stored at −80°C until analyzed. Blood samples were analyzed for HIV antigen/antibody and HIV-1 Gag DNA.

Identification of early and chronic HIV-1 infections

The updated CDC algorithm of laboratory testing for the diagnosis of early and chronic HIV-1 infection was used for this study as previously described15. Briefly, samples were identified as early HIV infection if HIV-1 DNA was detected after being positive with a 4th generation HIV ELISA (detection of both antigen and antibody) and negative with 3rd generation HIV ELISA (detection of HIV antibody only) while those from which HIV-1 DNA scored positive with both 4th and 3rd generation ELISA, were classified as chronic HIV infection. Genscreen™ ULTRA HIV-Ag-Ab ELISA kit (Biorad, Hercules, California) was used as the 4th generation ELISA kit while AiD™ anti-HIV 1+2 ELISA kit (Wantai, Beijing, China) was used as the 3rd generation ELISA kit. All assays were performed under strict biosafety conditions and according to the manufacturer’s recommendation. Furthermore, HIV-1 antibodies was also determined using Alere™ Determine™ HIV-1/2 Rapid Antibody Test kit (HIV Rapid Ab POC) (Alere, Chiba, Japan) in a subset of the samples. This test kit is approved for routine HIV diagnosis in the country.

PCR amplification and sequencing

Total DNA was extracted from whole blood using guanidium thiocyanate in house protocol. A fragment of the gag-pol region (900 base pairs) of the virus was amplified using previously published primers and cycling conditions 21 with slight modifications. Briefly, PCR was performed using a SuperScript III One-step RT-PCR system with platinum TaqDNA High fidelity polymerase (Jena Bioscience). Each 25µl reaction mixture contained 12.5µl reaction mix (2x), 4.5µl RNase-free water, 1µl each of each primer (20pmol/µl), 1µl Superscript III RT/Platinum Taq High Fidelity mix, and 5µl of template DNA. Pan-HIV-1_1R (CCT CCA ATT CCY CCT ATC ATT TT) and Pan-HIV-1_2F (GGG AAG TGA YAT AGC WGG AAC) were used. Cycling conditions were 94°C for 5min; 35 cycles of 94°C for 15s, 58°C for 30s, and 68°C for 1min 30s; and finally, 68°C for 10mins.

Positive HIV samples that was undetectable using the above stated primers were retested using another set of GAG primers for nested PCR as described previously22. Briefly, a 700-bp fragment corresponding to the p24 region was amplified using G00 and G01 for first round and G60-G25 for the second round. The PCR conditions were as follows: an initial denaturation step for 3 min at 92°C, followed by 30 cycles of 92°C for 10 s, 55°C for 30 s, and 1 min at 72°C, with a final extension for 7 min at 72°C. Amplicons were detected by gel electrophoresis. Furthermore, HIV-1 VIF gene of some samples were also detected and sequenced. As described previously23, Vif-1 (ATTCAAAATTTTCGGGTTTATTACAG) and TATED3-1 (AATTCTGCAACAACTGCTGTTTAT) primers were used for first round while Vif-2 (AGGTGAAGGGGCAGTAGTAATACA) and TATED-1(GCAGGAGTGGAAGCCATAATAAG) primers used for second round. The PCR conditions were as follows: 94°C for 5mins, followed by 35 cycles of 94°C for 30s, 60°C for 30s, 68°C for I min with a final extension for 4min at 68°C for 1minPositive PCR reactions were shipped on ice to Macrogen, South Korea for Big Dye sequencing using the same amplification primers (Pan-HIV-1_1R and Pan-HIV-1_2F; or G60 and G25; or Vif-2 and TATED-1 for VIF).

Detection of HIV-1 subtypes and recombination

The sequences were cleaned and edited using Chromas and Bioedit softwares. Subtyping was performed using a combination of four subtyping tools: The Rega HIV-1 Subtyping Tool, version 3.0 (http://dbpartners.stanford.edu/RegaSubtyping/), Comet, version 2.2 (http://comet.retrovirology.lu), National Center for Biotechnology Information, Bethesda, MD (http://www.ncbi.nlm.nih.gov/Blast.cgi) and jpHMMM: Improving the reliability of recombination prediction in HIV-1 (http://jphmm.gobics.de/submission_hiv). The first three tools were used simultaneously while jpHMMM was used to resolve discordant subtypes. Phylogenetic analyses were performed using MEGA software version 10. All consensus nucleotide sequences obtained in this study were submitted to GenBank. Database and assigned accession numbers KY786266-272 and MN943617-635.

Ethical approval

Ethical approvals for this research were obtained from the University of Ibadan/ University College Hospital (UI/UCH) Research and Ethics Committee (UI/EC/15/0076) and the Oyo State Ministry of Health Committee on Human Research (AD13/479/951). All results were delinked from patient identifiers and anonymized.

Eligibility/ Exclusion criteria

Only individuals between 18 and 65 years of age were included in the study. Individuals who already knew their HIV status were excluded from the study.

Data management and statistical analysis

Statistical analyses were performed using SPSS version 20 and graphpad prism. Categorical variables were compared using Z and chi-square tests while quantitative variables were compared using ANOVA. Test of significance was set at P<0.05.

Results

Patient characteristics

One thousand and twenty-eight (1028) individuals participated in this study out of which 890 were outpatients referred for malaria antigen testing. Voluntary blood donors were only recruited in Ibadan. Five hundred and ninety four (57.7%) of these individuals were female. The mean (±SD) ages for participants referred for malaria antigen test in Ibadan, Saki and voluntary blood donors were 37.2 (±9.1), 36.1 (±14.3) and 35.1 (±14.3) years respectively (Table 1).

View this table:
Table 1: Prevalence of early and chronic HIV-1 infection among Persons referred from malaria parasite testing and Voluntary Blood Donors

Values shown are in number and percentages. Statistical tests used: Z and chi-square (χ2) tests. Significant differences are in bold fonts while differences that are not significant are written as P>0.05.

Prevalence of early and chronic HIV infection

A total of 55 persons were HIV positive, giving a rate of infection of 5.35%. The HIV prevalence varied by location and groups tested. Twenty three (2.23%) individuals were at the early stages of HIV infection with an higher rate among voluntary blood donors (5.07%) compared to those referred for malaria antigen test (Ibadan: 2.22%; Saki: 1.36%) (P<0.03674). Differences in prevalence by gender were not significant for either early or chronic HIV infection (Table 1).

Proportions of HIV reactive samples based on serological assays

Table 2 shows the proportions of HIV reactive sample based on serological assays. This analysis was carried out on a subset of samples (671) collected from persons referred for malaria antigen test in Ibadan and Saki. Using 4th generation HIV Ag-Ab ELISA as the gold standard, HIV Rapid Ab POC (Ibadan: 1.95%; Saki: 2.95%) had significantly higher rates of false negative results in both locations compared to 3rd generation ELISA (HIV Ab ELISA) (Ibadan: 1.29%; Saki: 1.36%). The performance characteristics of HIV Rapid Ab POC are also presented. The sensitivity (95% CI) of HIV Rapid Ab POC is 52.38% (29.78-74.29). As shown in Figure 1, 14 samples were reactive on all serological assays while no sample was reactive on HIV Ab ELISA alone nor on HIV Ab ELISA and HIV Rapid Ab POC. Eight samples with HIV-1 antibodies (1.2%) were undetectable on HIV Rapid Ab POC.

View this table:
Table 2: Proportions of HIV reactive samples based on Enzyme Immunoassay

Values shown are in number and percentages. *Difference in numbers of reactive HIV samples between Alere™ Determine™ HIV-1/2 Rapid Antibody Test kit (HIV Rapid Ab POC) and 4th generation ELISA kit (HIV Ag/Ab ELISA) for samples collected in Ibadan was significant (P<0.0001). #Difference in numbers of reactive HIV samples between HIV Rapid Ab POC and HIV Ag/Ab ELISA for samples collected in Saki was significant (P<0.0001). aDifference in numbers of reactive samples (using HIV Ag/Ab ELISA) between Ibadan and Saki was significant (P<0.001). χ2 was used to test for significance. a= True Positive; b= False Negative; c= False Positive; d=True Negative.

Figure 1:
Figure 1: Diagram showing number of HIV positive samples on serological assays

Values are shown in numbers only. Total number of samples positive for an assay type corresponds to the addition of all numbers in the circle representing the assay. Samples positive on Alere™ Determine™ HIV-1/2 Rapid Antibody (HIV Rapid Kit), 3rd generation ELISA kit (HIV Ab ELISA) and 4th generation ELISA kit (HIV Ag/Ab) are represented in red, green and yellow colours respectively. Those positive on two assays are in grey while samples positive on the three assays are in light grey. No sample was reactive on 3rd generation HIV ELISA (HIV Ab ELISA) alone. Also no sample was reactive on both Alere™ Determine™ HIV-1/2 Rapid Antibody (HIV Rapid Kit) and HIV Ab ELISA.

Figure 2:
Figure 2: Summary of subtypes isolated from individuals at the early stages of HIV-1 infection

Values are shown in percentages only. A. Pie chart showing the distribution of subtypes isolated from persons referred for malaria parasite antigen testing in Saki, Nigeria. Total number of individuals at this location is 6. One sample was not sequenced. Three, 1 and 1 samples were subtyped as CRF-02AG, Recombinant GD and Unassigned respectively. B. Pie chart showing the distribution of subtypes isolated from persons referred for malaria parasite antigen testing in Ibadan, Nigeria. Total number of individuals at this location is 10. One sample was not sequenced. Four and 3 samples were subtyped as CRF-02AG and A respectively while one sample were subtyped as G and K each.

Figure 2C:
Figure 2C: Summary of subtypes isolated from individuals at the early stages of HIV-1 infection

C. Pie chart showing the distribution of subtypes isolated from Voluntary blood donors in Ibadan, Nigeria. Total number of individuals in this group is 7. One sample was not sequenced. Two samples each were subtyped as A, G and CRF02-AG.

Subtyping

Twenty out of the 23 isolates with early HIV infection were successfully sequenced. The predominant subtype detected was CRF02_AG (9; 45%). Other subtypes detected were A (5; 25%), G (3; 15%), K (1; 5%) and Recombinant GD (1; 5%). One of the sequenced viruses did not align with any subtype and was reported as unassigned (Table 3). Based on groups, CRF02-AG was the most predominant strain among persons referred for malaria antigen test (Saki: 50%; Ibadan 40%). Voluntary blood donors had the same number of HIV-1 subtypes A, G as well as CRF02-AG. Subtype K, recombinants and unassigned subtypes were found among persons referred for malaria antigen test.

View this table:
Table 3: Subtype classification of HIV-1 GAG gene isolated from individuals at the early stage of infection

Letter a in superscript corresponds to samples that the GAG gene were not sequenced, rather VIF gene was sequenced and used for subtyping.

Discussion

This study indicates that the prevalence of early HIV-1 infection is significantly high among febrile persons referred for malaria antigen testing (Ibadan: 2.22%; Saki: 1.36%) and voluntary blood donors (5.07%). Presently, the prevalence of HIV-1 among the general population in Nigeria is about 1.9%24. This then means that high prevalence of HIV-1 infection among high risk groups is masked by low prevalence in the general population as previously hypothesized25. To effectively control the prevalence and incidence of HIV-1 infection in the country, it is important that persons at the early stages of infection are identified and placed on treatment early. The strategy used in this study to identify early HIV-1 infection seems applicable for other high risk groups’ aside febrile persons. Identifying and treating HIV-1 infected individuals during the early stages of infection will go a long way in reducing new HIV-1 infections as well as decrease the number AIDS-related deaths in the country, since undetectable equals untransmittable26. Furthermore, results of this study show that CRF02-AG, subtypes A and G in that order still remains the predominant circulating HIV-1 subtypes in Oyo state as well as among high risk groups in the state. These strains have been shown to be circulating in the region since 199520,27. We also showed that HIV-1 Rapid antibody kit is not advisable for use as a diagnostic tool for early HIV-1 infection. A previous study in Nigeria that characterized acute HIV-1 infection among high risk groups had a lower prevalence (0.05%) compared to what was observed in this study28. This may be due to the fact that HIV-1 Rapid Antibody was used to eliminate seroconversion in the study.

Results of HIV-1 prevalence in this study is very similar to what was obtained from our previous study among persons referred for malaria antigen test15. Furthermore, our results on the prevalence of HIV-1 infection among blood donors is not different from previous studies on this group that used ELISA based tests for diagnosis9,19,29. Previous studies on HIV-1 prevalence among blood donors in Nigeria have reported varying proportions9,30–38. Aside the fact that various regions in the country have varying HIV-1 prevalence24, the method used for HIV-1 diagnosis played a significant role in the numbers of infected persons detected. In 2008, Odaibo39 et al., reported that 6(1.2%) out of 500 antibody-negative blood donor samples had HIV-1 antigens and cDNA. This report is not different from what was observed in this study in which 8(1.2%) samples positive on HIVAg/Ab ELISA were undetectable on Antibody based testing kits (see Figure 1). The case is really worsened for HIV-1 Rapid POC used in this study in which 16 (2.4%) samples positive on either HIV Ag/Ab ELISA and/or HIV Ab ELISA were undetectable on the platform. The average score of HIV Rapid POC sensitivity observed in this study is similar to what was observed by Mba et al., 201840. In the study which was carried out among blood donors in Gabon, the authors argued that Rapid antibody kits may not be very useful for pre-donation HIV diagnosis.

It is important that blood donation testing centers use HIV Antigen and Antibody based ELISA tests for pre donation screening at the minimum. Other authors have showed the cost benefits of using only HIV antigen and antibody based ELISA test kits for pre donation blood screening rather than the two step algorithm involving the use of HIV Rapid antibody kits41. Findings from this study suggest that missed opportunities for HIV-1 diagnosis still occur even after the presence of detectable antibodies in blood samples. Reasons for this may be that serological methods for detecting HIV-1 infection have different sensitivities across various circulating subtypes. Although we could not associate specific sensitivity scores to HIV-1 screening methods against the various subtypes identified in this study, we have showed that HIV-1 Rapid antibody kits may not be very effective in detecting HIV-1 antibodies in areas where multiple HIV-1 subtypes circulate. This missed diagnosis leads to further transmission of the virus to susceptible individuals. It is unadvisable to use HIV-1 Rapid antibody kits for pre-donation screening in regions with diverse circulating HIV-1 subtypes40.

We have previously reported the detection of CRF02_AG, subytpe K, recombinant strain GD and an unassigned subtype among persons referred for malaria parasite testing (KY786266-272)15. In this study, more CRF02_AG, subtypes A and G were identified among febrile persons and blood donors. As earlier stated, CRF02_AG remains the predominant subtype among high risk groups in Oyo State. The strain is the predominant circulating virus in West Africa6,20,27,42,43. Although CRF02_AG was first described in Ibadan, Nigeria, the origin of the virus is still not known especially now that the strain is prevalent in several regions of the world. Subtypes A and G have also been previously reported as circulating in Oyo state as well as in other parts of Nigeria. A recent study identified CRF02_AG, as well as subtypes G and A as the predominant circulating HIV-1 strains in Ibadan, Nigeria6.

It is important that in depth analysis of HIV-1 viral diversities in geographical regions are carried out. This is because subtypes differences have been associated with varying patterns of replicative capacities, diagnosis, transmission and pathogenesis. In another study, we have showed that HIV-1 strains circulating in Oyo State are associated with renal dysfunctions and reduced proportions of T cells in infected individuals during early stages of HIV-1 infection44. Findings in this study observed more subtypes in Ibadan metropolis (urban settlement) compared to Saki town (rural settlement). Recent studies using phylodynamic tools have suggested that HIV-1 strains originate and expand in urban areas before migrating to smaller rural centers6. There is the need to describe the phylodynamics of HIV-1 subtypes in other states of the country as this will shed further light into the diversity of the virus.

In summary, we have showed that the genetic diversity of HIV-1 strains among infected individuals in Oyo State, Nigeria is still relatively high. This diversity is likely impacting on diagnosis. Our study also suggests that screening persons for early HIV-1 infection is best done using Antigen/Antibody based ELISA techniques for elimination of seroconversion. Early HIV-1 infected individuals are the major drivers of new infections. Hence, the need to use highly sensitive diagnostic tools for HIV-1 identification among them. This is particularly important for high risk groups such as voluntary blood donors. Studies examining the impact of host immune pressures on the generation of HIV-1 immune escape mutants during the early stages of infection are ongoing.

Data Availability

Data will be made available by the corresponding author upon request.

Sequence Notes

All consensus nucleotide sequences obtained in this study were submitted to GenBank. Database and assigned accession numbers KY786266-272 and MN943617-635.

Reprints requests

Reprints requested should be directed to Prof Gerogina N. Odaibo, Department of Virology, College of Medicine, University College Hospital, Ibadan, Nigeria. foreodabo@hotmail,com

Acknowledgements

We thank all individuals who participated in this study. Special appreciation to Mrs. Fadimu and Mrs. Adeyefa (both of Blood bank, University College Hospital, Ibadan, Nigeria) for linking us up with volunteer blood donors. This study was supported by University of Ibadan MEPI Junior Faculty Research Training Program (UI-MEPI-J) mentored research award through National Institute of Health (NIH) USA grant funded by Fogarty International Centre, the office of AIDS Research and National Human Genome Research Institute of NIH, the Health Resources and Services Administration (HRSA) and the Office of the U.S. Global AIDS Coordinator under award number D43TW010140 to BO. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. The authors have no conflict of interest to declare.

References

  1. 1.↵
    UNAIDS. Global HIV & AIDS statistics — 2019 fact sheet | UNAIDS. https://www.unaids.org/en/resources/fact-sheet. Published 2019. accessed March 1, 2020.
  2. 2.↵
    Peeters M, Toure-kane C, Nkengasong JN. Genetic diversity of HIV in AfricalJ: impact on diagnosis, treatment, vaccine development and trials. AIDS. 2003;17(May):2547–2560.
    OpenUrlCrossRefPubMedWeb of Science
  3. 3.↵
    UNAIDS. New Fast Track Strategy to end AIDS by 2030. 2020.
  4. 4.↵
    Peeters M. The genetic variability of HIV-1 and its implications. Transfus Clin Biol. 2001;8:222–225.
    OpenUrlCrossRefPubMedWeb of Science
  5. 5.↵
    Peeters M, Jung M, Ayouba A. The origin and molecular epidemiology of HIV. Expert Rev. 2013;11(9):885–896.
    OpenUrl
  6. 6.↵
    Nazziwa J, Faria NR, Chaplin B, et al. Characterisation of HIV-1 Molecular Epidemiology in Nigeria: Origin, Diversity, Demography and Geographic Spread. Sci Rep. 2020;10(1):3468. doi:10.1038/s41598-020-59944-x
    OpenUrlCrossRef
  7. 7.↵
    Fayemiwo SA, Odaibo GN, Oni AA, Ajayi AA, Bakare RA, Olaleye DO. Genital ulcer diseases among HIV-infected female commercial sex workers in Ibadan, Nigeria. Afr J Med Med Sci. 2011;40(1):39–46. http://www.ncbi.nlm.nih.gov/pubmed/21834260. accessed March 1, 2020.
    OpenUrlPubMed
  8. 8.↵
    Oyefara JL. Food insecurity, HIV/AIDS pandemic and sexual behaviour of female commercial sex workers in Lagos metropolis, Nigeria. Sahara J. 2007;4(2):626–635. doi:10.1080/17290376.2007.9724884
    OpenUrlCrossRefPubMed
  9. 9.↵
    Osaro E, Mohammed N, Zama I, et al. Prevalence of p24 antigen among a cohort of HIV antibody negative blood donors in Sokoto, north western Nigeria - The question of safety of blood transfusion in Nigeria. Pan Afr Med J. 2014;18:174. doi:10.11604/pamj.2014.18.174.3449
    OpenUrlCrossRef
  10. 10.↵
    Odaibo GN, Adewole IF, Olaleye DO. High Rate of Non-detectable HIV-1 RNA among Antiretroviral Drug Naive HIV Positive Individuals in Nigeria. Virol Res Treat. 2013;4:VRT.S12677. doi:10.4137/VRT.S12677
    OpenUrlCrossRef
  11. 11.↵
    Atilola GO, Akpa OM, Komolafe IOO. HIV/AIDS and the long-distance truck drivers in south-west Nigeria: A cross-sectional survey on the knowledge, attitude, risk behaviour and beliefs of truckers. J Infect Public Health. 2010;3(4):166–178. doi:10.1016/j.jiph.2010.08.002
    OpenUrlCrossRefPubMed
  12. 12.
    Azuonwu O, Erhabor O, Frank-Peterside N. HIV infection in long-distance truck drivers in a low income setting in the Niger Delta of Nigeria. J Community Health. 2011;36(4):583–587. doi:10.1007/s10900-010-9344-4
    OpenUrlCrossRefPubMed
  13. 13.↵
    Ijeoma A, Ejikeme A, Theodora O, Chika O. Knowledge, attitude, willingness of HIV counseling and testing and factors associated with it, among long distant drivers in Enugu, Nigeria: an opportunity in reduction of HIV prevalence. Afr Health Sci. 2018;18(4):1088–1097. doi:10.4314/ahs.v18i4.30
    OpenUrlCrossRef
  14. 14.↵
    Njoku OS, Manak MM, O’Connell RJ, et al.An evaluation of selected populations for HIV-1 vaccine cohort development in Nigeria. PLoS One. 2016;11(12):1–14. doi:10.1371/journal.pone.0166711
    OpenUrlCrossRefPubMed
  15. 15.↵
    Olusola BA, Olaleye DO, Odaibo GN. Early HIV infection among persons referred for malaria parasite testing in Nigeria. Arch Virol. 2017;163(2):439–445. doi:10.1007/s00705-017-3599-3
    OpenUrlCrossRef
  16. 16.
    Sanders EJ, Mugo P, Prins HAB, et al. Acute HIV-1 infection is as common as malaria in young febrile adults seeking care in coastal Kenya. 2014. doi:10.1097/QAD.0000000000000245
    OpenUrlCrossRefPubMedWeb of Science
  17. 17.↵
    Sanders EJ, Wahome E, Powers KA, et al. Targeted screening of at-risk adults for acute HIV-1 infection in sub-Saharan Africa. AIDS J. 2016;29(0 3):1–24. doi:10.1097/QAD.0000000000000924.Targeted
    OpenUrlCrossRef
  18. 18.↵
    Olowe OA, Mabayoje VO, Akanbi O, et al. HIV P24 antigen among HIV antibody seronegative blood donors in Osogbo Osun State, South Western Nigeria. Pathog Glob Health. 2016;110(4-5):205–208. doi:10.1080/20477724.2016.1205311
    OpenUrlCrossRef
  19. 19.↵
    Japhet M, Adewumi O, Adesina O, Donbraye E. High prevalence of HIV p24 antigen among HIV antibody negative prospective blood donors in Ile-Ife, Nigeria. J Immunoass Immunochem. 2016;1819(April). doi:10.1080/15321819.2016.1174133
    OpenUrlCrossRef
  20. 20.↵
    Sankalé J, Langevin S, Odaibo G, et al. The Complexity of Circulating HIV Type 1 Strains in Oyo State, Nigeria. 2007;23(8):1020–1025. doi:10.1089/aid.2006.0304
    OpenUrlCrossRef
  21. 21.↵
    Gall A, Ferns B, Morris C, et al. Universal Amplification, Next-Generation Sequencing, and Assembly of HIV-1 Genomes. 2012. doi:10.1128/JCM.01516-12
    OpenUrlAbstract/FREE Full Text
  22. 22.↵
    Vidal N, Peeters M, Mulanga-Kabeya C, et al. Unprecedented Degree of Human Immunodeficiency Virus Type 1 (HIV-1) Group M Genetic Diversity in the Democratic Republic of Congo Suggests that the HIV-1 Pandemic Originated in Central Africa. J Virol. 2000;74(22):10498–10507. doi:10.1128/jvi.74.22.10498-10507.2000
    OpenUrlAbstract/FREE Full Text
  23. 23.↵
    Gourraud P, Karaouni A, Woo J, et al. APOBEC3H haplotypes and HIV-1 Pro-Viral vif DNA Sequence Diversity in Early Untreated HIV-1 Infection. Hum Immunol. 2011;72(3):207–212. doi:10.1038/jid.2014.371
    OpenUrlCrossRefPubMed
  24. 24.↵
    UNAIDS. Nigeria | UNAIDS. 2018. https://www.unaids.org/en/regionscountries/countries/nigeria. accessed March 1, 2020.
  25. 25.↵
    Kiwanuka N, Ssetaala A, Mpendo J, et al. High HIV-1 prevalence, risk behaviours, and willingness to participate in HIV vaccine trials in fishing communities on Lake Victoria, Uganda. J Int AIDS Soc. 2013;16:1–8. doi:10.7448/IAS.16.1.18621
    OpenUrlCrossRefPubMed
  26. 26.↵
    Eisinger R, Dieffenbach C, Fauci A. HIV Viral Load and Transmissibility of HIV Infection Undetectable Equals Untransmittable. JAMA. 2019;321(5). doi:10.1001/jama.2018.21167
    OpenUrlCrossRefPubMed
  27. 27.↵
    Olaleye D. Isolation and characterization of a new subtype A variant of human immunodeficiency virus type I from Nigeria. 1996;1996(I):97–106.
    OpenUrl
  28. 28.↵
    Charurat M, Nasidi A, Delaney K, et al. Characterization of Acute HIV-1 Infection in High-Risk Nigerian Populations. J Infect Dis. 2012;205:1239–1247. doi:10.1093/infdis/jis103
    OpenUrlCrossRefPubMed
  29. 29.↵
    Okoroiwu HU, Okafor IM, Asemota EA, Okpokam DC. Seroprevalence of transfusion-transmissible infections (HBV, HCV, syphilis and HIV) among prospective blood donors in a tertiary health care facility in Calabar, Nigeria; An eleven years evaluation. BMC Public Health. 2018;18(1):1–8. doi:10.1186/s12889-018-5555-x
    OpenUrlCrossRefPubMed
  30. 30.↵
    Buseri FI, Muhibi MA, Jeremiah ZA. Sero-epidemiology of transfusion-transmissible infectious diseases among blood donors in Osogbo, south-west Nigeria. Blood Transfus. 2009;7(4):293–299. doi:10.2450/2009.0071-08
    OpenUrlCrossRefPubMed
  31. 31.
    Umolu PI, Okoror LE, Orhue P. Human immunodeficiency virus (HIV) seropositivity and hepatitis B surface antigenemia (HBSAG) among blood donors in Benin city, Edo state, Nigeria. Afr Health Sci. 2005;5(1):55–58. http://www.ncbi.nlm.nih.gov/pubmed/15843132. accessed February 29, 2020.
    OpenUrlPubMed
  32. 32.
    Iyalla C, Ejele AO, Okoh DA, Igbigbi E. Seroprevalence study of HTLV-1 and 2 in prospective blood donors and pregnant women in Port Harcourt, Nigeria. African J Infect Dis. 2015;9(2):57–60. doi:10.4314/ajid.v9i2.8
    OpenUrlCrossRef
  33. 33.
    Dirisu J, Alli T, Adegoke A, Osazuwa F. A Survey of prevalence of serum antibodies to human immunodeficiency deficiency virus (HIV), hepatitis B virus (HBV) and hepatitis C virus (HCV) among blood donors. N Am J Med Sci. 2011;3(1):35. doi:10.4297/najms.2011.335
    OpenUrlCrossRef
  34. 34.
    Hassan A, Muktar HM, Mamman AI, Ahmed AJ, Isa AH, Babadoko AA. The incidence of HIV among blood donors in Kaduna, Nigeria. Afr Health Sci. 2007;7(4):253. http://www.ncbi.nlm.nih.gov/pubmed/21499493. accessed February 29, 2020.
    OpenUrlPubMed
  35. 35.
    Olajubu FA, Osinupebi OA, Deji-Agboola M, Jagun EO. Seroprevalence of HIV among blood donors, antenatal women and other patients in a tertiary hospital in Nigeria. Braz J Infect Dis. 2009;13(4):280–283. doi:10.1590/s1413-86702009000400008
    OpenUrlCrossRefPubMed
  36. 36.
    Motayo BO, Faneye AO, Udo UA, Olusola BA, Ezeani I, Ogiogwa JI. Seroprevalence of transfusion transmissible infections (TTI), in first time blood donors in Abeokuta, Nigeria. Afr Health Sci. 2015;15(1). doi:10.4314/ahs.v15i1.3
    OpenUrlCrossRef
  37. 37.
    Egah DZ, Banwat EB, Audu ES, et al. Hepatitis B surface antigen, hepatitis C and HIV antibodies in a low-risk blood donor group, Nigeria. East Mediterr Heal J. 2007;13(4):961–966.
    OpenUrl
  38. 38.↵
    Chikwem JO, Mohammed I, Okara GC, Ukwandu NCD, Ola TO. Prevalence of transmissible blood infections among blood donors at the University of Maiducuri Teaching Hospital, Maiduguri, Nigeria. East Afr Med J. 1997;74(4):213–216.
    OpenUrlPubMedWeb of Science
  39. 39.↵
    Odaibo GN, Taiwo A, Aken’Ova YA, Olaleye DO. Detection of HIV antigen and cDNA among antibody-negative blood samples in Nigeria. Trans R Soc Trop Med Hyg. 2008;102(3):284–287. doi:10.1016/j.trstmh.2007.12.001
    OpenUrlCrossRefPubMed
  40. 40.↵
    Eko Mba JM, Bisseye C, Mombo LE, et al. Assessment of rapid diagnostic tests and fourth-generation Enzyme-Linked Immunosorbent Assays in the screening of Human Immunodeficiency and Hepatitis B virus infections among first-time blood donors in Libreville (Gabon). J Clin Lab Anal. 2019;33(3). doi:10.1002/jcla.22824
    OpenUrlCrossRef
  41. 41.↵
    Shittu AO, Olawumi HO, Adewuyi JO. Pre-donation screening of blood for transfusion transmissible infections: the gains and the pains - experience at a resource limited blood bank. Ghana Med J. 2014;48(3):158–162. doi:10.4314/gmj.v48i3.7
    OpenUrlCrossRef
  42. 42.
    Mboudjeka I, Zekeng L, Takehisa J, et al. HIV type 1 genetic variability in the northern part of Cameroon. AIDS Res Hum Retroviruses. 1999;15(11):951–956. doi:10.1089/088922299310458
    OpenUrlCrossRefPubMed
  43. 43.
    Ragupathy V, Zhao J, Wood O, et al. Identification of new, emerging HIV-1 unique recombinant forms and drug resistant viruses circulating in Cameroon. Virol J. 2011;8:185. doi:10.1186/1743-422X-8-185
    OpenUrlCrossRefPubMed
  44. 44.↵
    Olusola BA, Kabelitz D, Olaleye DO, Odaibo GN. Early HIV infection is associated with reduced proportions of gamma delta T subsets as well as high creatinine and urea levels. Scand J Immunol. 2020;(June 2019):1–13. doi:10.1111/sji.12868
    OpenUrlCrossRef
Back to top
Posted April 14, 2020.
Download PDF
Data/Code
Email
Detection of Early HIV-1 Infection among Febrile Persons and Blood Donors in Oyo State, Nigeria
Babatunde A. Olusola, David O. Olaleye, Georgina N. Odaibo
medRxiv 2020.04.09.20058966; doi: https://doi.org/10.1101/2020.04.09.20058966
Twitter logo Facebook logo LinkedIn logo Mendeley logo
Citation Tools

Subject Area