- Split View
-
Views
-
Cite
Cite
Zhongliang Wang, Bohan Yang, Qianwen Li, Lu Wen, Ruiguang Zhang, Clinical Features of 69 Cases With Coronavirus Disease 2019 in Wuhan, China, Clinical Infectious Diseases, Volume 71, Issue 15, 1 August 2020, Pages 769–777, https://doi.org/10.1093/cid/ciaa272
- Share Icon Share
Abstract
From December 2019 to February 2020, 2019 severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) has caused a serious outbreak of coronavirus disease 2019 (COVID-19) in Wuhan, China. Related clinical features are needed.
We reviewed 69 patients who were hospitalized in Union hospital in Wuhan between 16 January and 29 January 2020. All patients were confirmed to be infected with SARS-CoV-2, and the final date of follow-up was 4 February 2020.
The median age of 69 enrolled patients was 42.0 years (interquartile range 35.0–62.0), and 32 patients (46%) were men. The most common symptoms were fever (60 [87%]), cough (38 [55%]), and fatigue (29 [42%]). Most patients received antiviral therapy (66 [98.5%] of 67 patients) and antibiotic therapy (66 [98.5%] of 67 patients). As of 4 February 2020, 18 (26.9%) of 67 patients had been discharged, and 5 patients had died, with a mortality rate of 7.5%. According to the lowest SpO2 during admission, cases were divided into the SpO2 ≥ 90% group (n = 55) and the SpO2 < 90% group (n = 14). All 5 deaths occurred in the SpO2 < 90% group. Compared with SpO2 ≥ 90% group, patients of the SpO2 < 90% group were older and showed more comorbidities and higher plasma levels of interleukin (IL) 6, IL10, lactate dehydrogenase, and C reactive protein. Arbidol treatment showed tendency to improve the discharging rate and decrease the mortality rate.
COVID-19 appears to show frequent fever, dry cough, and increase of inflammatory cytokines, and induced a mortality rate of 7.5%. Older patients or those with underlying comorbidities are at higher risk of death.
Coronaviruses are enveloped, single-stranded, positive-sense RNA viruses that are phenotypically and genotypically diverse and are widespread in bats around the world. Coronaviruses can also be found in many other species as well, including humans, other mammals, and birds. They may cause respiratory, enteric, hepatic, or neurologic diseases [1, 2]. In humans, there are 4 prevalent coronaviruses (229E, OC43, NL63, and HKU1), which typically cause common respiratory symptoms. Usually, the symptoms caused by coronaviruses are mild. But in the past 2 decades, 2 other strains—severe acute respiratory syndrome coronavirus (SARS-CoV) and Middle East respiratory syndrome coronavirus (MERS-CoV) had caused 2 large-scale epidemics, with mortality rates of 10% for SARS-CoV and 37% for MERS-CoV [3].
In late December 2019, a series of cases with respiratory symptoms and typical chest computed X-ray tomography (CT) features were reported in Wuhan, Hubei, China. A previously unknown betacoronavirus was then discovered through the use of full-genome sequencing in samples from these patients and was believed to be the pathogen of coronavirus disease 2019 (COVID-19) [4, 5]. The new betacoronavirus was named 2019 severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) and formed another clade within the subgenus sarbecovirus, Orthocoronavirinae subfamily. COVID-19 has caused an outbreak in China since late December 2019 and continues to evolve with the number of suspected cases and deaths increasing daily in and outside of China. We describe the epidemiological, clinical, laboratory, and radiologic features, treatment, and prognosis of patients with confirmed infection of SARS-CoV-2 who were hospitalized in Union Hospital, Wuhan. The difference of clinical features between the SpO2 ≥ 90% group and the SpO2 < 90% group would also be compared.
METHODS
Patients
In late December 2019, several hospitals of Wuhan reported clusters of patients with pneumonia of unknown cause, which was identified as SARS-CoV-2 soon after. The local government proclaimed a list of designated hospitals to treat patients infected with SARS-CoV-2, including the Union hospital. Generally, the patients of Union hospital come from all regions of Wuhan, especially the Hankou district. In this program, all consecutive patients with confirmed COVID-19 admitted to the main campus of Union hospital from 16 January to 29 January 2020 were enrolled. All patients with COVID-19 enrolled in this study were diagnosed and admitted in accordance with the guideline of the national health commission of China [6]. The final date of follow-up was 4 February 2020.
Data Collection
We reviewed clinical charts, nursing records, laboratory results, and chest CT characteristics for all patients. Epidemiological, clinical, imaging, and serological records and treatment and outcomes data were collected from the electronic medical network of Union hospital. To ensure the accuracy of data, 2 independent researchers were arranged to review and check the data form.
Real-Time Reverse Transcription Polymerase Chain Reaction (RT-PCR) Tests
The confirmation of COVID-19 is achieved by RT-PCR detection of throat swab samples of suspected patients. Following the recommendation of China National Center for Disease Control, 2 target genes were set as described previously [5], including open reading frame1ab (ORF1ab) and nucleocapsid protein (N), and simultaneously amplified and tested during the real-time RT-PCR assay. Target 1 (ORF1ab): forward primer CCCTGTGGGTTTTACACTTAA; reverse primer ACGATTGTGCATCAGCTGA; and the probe 5′-FAM- CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1-3′. Target 2 (N): forward primer GGGGAACTTCTCC TGCTAGAAT; reverse primer CAGACATTTTGCTCTCAAG CTG; and the probe 5′-FAM- TTGCTGCTGCTTGACAGATT-TAMRA-3′. A cycle threshold value (Ct value) <37 was defined as a positive record, and a Ct value that exceeds 40 was defined as a negative test.
Statistical Analysis
Continuous variables were reported as median (IQR), and compared with the Mann-Whitney U test. Categorical variables were reported as number and percentages, and compared by χ 2 test or Fisher exact test between the SpO2 ≥ 90% group and the SpO2 < 90% group, or the groups treated specific agent or not. Statistical analysis was performed with SPSS software (version 26.0). A P value of <.05 was considered to indicate statistical significance. All probabilities are 2-tailed.
RESULTS
The enrolled 69 patients were all confirmed infected with SARS-CoV-2 with PCR tests of throat swabs. The median age of the patients was 42.0 years (interquartile range [IQR] 35.0–62.0, Table 1). Among them, 35 (51%) were aged 30–49 years, and 19 (28%) were aged 50–69 years (Figure 1). Also, 32 patients (46%) were men, and 37 patients (54%) were women. According to the lowest SpO2 records during admission, we divided these patients into 2 groups: the SpO2 ≥ 90% group (n = 55) and the SpO2 < 90% group (n = 14). The median age of the SpO2 ≥ 90% group was 37.0 years (IQR 32.0–51.0), whereas the median age of the SpO2 < 90% group was 70.5 years (IQR 62.0–77.0). In the SpO2 < 90% group, the median occurrence time of lowest SpO2 was 1 day (IQR 0–2.0) after admission, and the median interval from onset of illness to time of lowest SpO2 during admission was 8.5 days (IQR 7.0–11.0). Of the 69 patients, less than half had underlying comorbidities (25 [36%]), including hypertension (9 [13%]), cardiovascular disease (8 [12%]), and diabetes (7 [10%]), and so forth. Patients of the SpO2 < 90% group showed more underlying comorbidities when compared with the SpO2 ≥ 90% group, such as hypertension (5 [36%] vs 4 [7%], P = .014), cardiovascular disease (5 [36%] vs 3 [5%], P = .07), and diabetes (6 [43%] vs 1 [2%], P < .001).
. | All Patients (N = 69) . | SpO2 ≥ 90% (n = 55) . | SpO2 < 90% (n = 14) . | P Value . |
---|---|---|---|---|
Age (y) | 42.0 (35.0–62.0) | 37.0 (32.0–51.0) | 70.5 (62.0–77.0) | <.001 |
Sex | ||||
Male | 32 (46%) | 25 (45%) | 7 (50%) | .761 |
Female | 37 (54%) | 30 (55%) | 7 (50%) | |
From admission to time of lowest SpO2 (d) | 2.0 (1.0–3.0) | 2.0 (1.0–3.0) | 1.0 (0–2.0) | .205 |
From onset to time of lowest SpO2 (d) | 8.0 (7.0–11.0) | 8.0 (6.0–11.0) | 8.5 (7.0–11.0) | .892 |
Comorbidity | ||||
Hypertension | 9 (13%) | 4 (7%) | 5 (36%) | .014 |
Cardiovascular disease | 8 (12%) | 3 (5%) | 5 (36%) | .007 |
Diabetes | 7 (10%) | 1 (2%) | 6 (43%) | <.001 |
Chronic obstructive | 4 (6%) | 2 (4%) | 2 (14%) | .181 |
Pulmonary disease | ||||
Malignancy | 4 (6%) | 3 (5%) | 1 (7%) | .605 |
Asthma | 2 (3%) | 2 (4%) | 0 | .633 |
Chronic hepatitis | 1 (1%) | 1 (2%) | 0 | .797 |
Fever at onset of illness | 60 (87%) | 47 (85%) | 13 (93%) | .674 |
Highest temperature, °C | 38.5 (38.0–38.8) | 38.5 (38.0–38.8) | 38.3 (38.0–38.8) | .525 |
<37.3 | 9 (13%) | 8 (15%) | 1 (7%) | .579 |
37.3–38 | 7 (10%) | 5 (9%) | 2 (14%) | |
38.1–39 | 40 (58%) | 31 (56%) | 9 (64%) | |
>39 | 13 (19%) | 11 (20%) | 2 (14%) | |
Fever on day 10 from onset of illness | 30 (43%) | 21 (38%) | 9 (64%) | .079 |
Temperature, °C | 37.1 (36.8–38.0) | 37.5 (37.2–38.1) | 37.0 (36.7–38.0) | .038 |
<37.3 | 39 (57%) | 34 (62%) | 5 (36%) | .296 |
37.3–38 | 13 (19%) | 9 (16%) | 4 (29%) | |
38.1–39 | 15 (22%) | 11 (20%) | 4 (29%) | |
>39 | 2 (3%) | 1 (2%) | 1 (7%) | |
Symptoms at onset of illness | ||||
Cough | 38 (55%) | 30 (55%) | 8 (57%) | .553 |
Fatigue | 29 (42%) | 22 (40%) | 7 (50%) | .499 |
Myalgia | 21 (30%) | 19 (35%) | 2 (14%) | .124 |
Sputum production | 20 (29%) | 16 (29%) | 4 (29%) | .624 |
Dyspnea | 20 (29%) | 13 (24%) | 7 (50%) | .057 |
Oppression in chest | 14 (20%) | 12 (22%) | 2 (14%) | .418 |
Diarrhea | 10 (14%) | 8 (15%) | 2 (14%) | .674 |
Headache | 10 (14%) | 10 (18%) | 0 | .086 |
Anorexia | 7 (10%) | 6 (11%) | 1 (7%) | .564 |
Chest pain | 6 (9%) | 4 (7%) | 2 (14%) | .352 |
Pharyngalgia | 6 (9%) | 5 (9%) | 1 (7%) | .648 |
Dizziness | 5 (7%) | 4 (7%) | 1 (7%) | .734 |
Palpitation | 5 (7%) | 4 (7%) | 1 (7%) | .734 |
Vomiting | 3 (4%) | 2 (4%) | 1 (7%) | .499 |
. | All Patients (N = 69) . | SpO2 ≥ 90% (n = 55) . | SpO2 < 90% (n = 14) . | P Value . |
---|---|---|---|---|
Age (y) | 42.0 (35.0–62.0) | 37.0 (32.0–51.0) | 70.5 (62.0–77.0) | <.001 |
Sex | ||||
Male | 32 (46%) | 25 (45%) | 7 (50%) | .761 |
Female | 37 (54%) | 30 (55%) | 7 (50%) | |
From admission to time of lowest SpO2 (d) | 2.0 (1.0–3.0) | 2.0 (1.0–3.0) | 1.0 (0–2.0) | .205 |
From onset to time of lowest SpO2 (d) | 8.0 (7.0–11.0) | 8.0 (6.0–11.0) | 8.5 (7.0–11.0) | .892 |
Comorbidity | ||||
Hypertension | 9 (13%) | 4 (7%) | 5 (36%) | .014 |
Cardiovascular disease | 8 (12%) | 3 (5%) | 5 (36%) | .007 |
Diabetes | 7 (10%) | 1 (2%) | 6 (43%) | <.001 |
Chronic obstructive | 4 (6%) | 2 (4%) | 2 (14%) | .181 |
Pulmonary disease | ||||
Malignancy | 4 (6%) | 3 (5%) | 1 (7%) | .605 |
Asthma | 2 (3%) | 2 (4%) | 0 | .633 |
Chronic hepatitis | 1 (1%) | 1 (2%) | 0 | .797 |
Fever at onset of illness | 60 (87%) | 47 (85%) | 13 (93%) | .674 |
Highest temperature, °C | 38.5 (38.0–38.8) | 38.5 (38.0–38.8) | 38.3 (38.0–38.8) | .525 |
<37.3 | 9 (13%) | 8 (15%) | 1 (7%) | .579 |
37.3–38 | 7 (10%) | 5 (9%) | 2 (14%) | |
38.1–39 | 40 (58%) | 31 (56%) | 9 (64%) | |
>39 | 13 (19%) | 11 (20%) | 2 (14%) | |
Fever on day 10 from onset of illness | 30 (43%) | 21 (38%) | 9 (64%) | .079 |
Temperature, °C | 37.1 (36.8–38.0) | 37.5 (37.2–38.1) | 37.0 (36.7–38.0) | .038 |
<37.3 | 39 (57%) | 34 (62%) | 5 (36%) | .296 |
37.3–38 | 13 (19%) | 9 (16%) | 4 (29%) | |
38.1–39 | 15 (22%) | 11 (20%) | 4 (29%) | |
>39 | 2 (3%) | 1 (2%) | 1 (7%) | |
Symptoms at onset of illness | ||||
Cough | 38 (55%) | 30 (55%) | 8 (57%) | .553 |
Fatigue | 29 (42%) | 22 (40%) | 7 (50%) | .499 |
Myalgia | 21 (30%) | 19 (35%) | 2 (14%) | .124 |
Sputum production | 20 (29%) | 16 (29%) | 4 (29%) | .624 |
Dyspnea | 20 (29%) | 13 (24%) | 7 (50%) | .057 |
Oppression in chest | 14 (20%) | 12 (22%) | 2 (14%) | .418 |
Diarrhea | 10 (14%) | 8 (15%) | 2 (14%) | .674 |
Headache | 10 (14%) | 10 (18%) | 0 | .086 |
Anorexia | 7 (10%) | 6 (11%) | 1 (7%) | .564 |
Chest pain | 6 (9%) | 4 (7%) | 2 (14%) | .352 |
Pharyngalgia | 6 (9%) | 5 (9%) | 1 (7%) | .648 |
Dizziness | 5 (7%) | 4 (7%) | 1 (7%) | .734 |
Palpitation | 5 (7%) | 4 (7%) | 1 (7%) | .734 |
Vomiting | 3 (4%) | 2 (4%) | 1 (7%) | .499 |
Data are median (IQR) or n/N (%), in which N is the total number of patients with available data. P values are comparing the SpO2 ≥ 90% group and the SpO2 < 90% group from Mann-Whitney U test, χ 2 test, or Fisher exact test. P < .05 was considered statistically significant.
Abbreviations: IQR, interquartile range; SARS-CoV-2, 2019 severe acute respiratory syndrome coronavirus 2; SpO2, saturation of peripheral oxygen.
. | All Patients (N = 69) . | SpO2 ≥ 90% (n = 55) . | SpO2 < 90% (n = 14) . | P Value . |
---|---|---|---|---|
Age (y) | 42.0 (35.0–62.0) | 37.0 (32.0–51.0) | 70.5 (62.0–77.0) | <.001 |
Sex | ||||
Male | 32 (46%) | 25 (45%) | 7 (50%) | .761 |
Female | 37 (54%) | 30 (55%) | 7 (50%) | |
From admission to time of lowest SpO2 (d) | 2.0 (1.0–3.0) | 2.0 (1.0–3.0) | 1.0 (0–2.0) | .205 |
From onset to time of lowest SpO2 (d) | 8.0 (7.0–11.0) | 8.0 (6.0–11.0) | 8.5 (7.0–11.0) | .892 |
Comorbidity | ||||
Hypertension | 9 (13%) | 4 (7%) | 5 (36%) | .014 |
Cardiovascular disease | 8 (12%) | 3 (5%) | 5 (36%) | .007 |
Diabetes | 7 (10%) | 1 (2%) | 6 (43%) | <.001 |
Chronic obstructive | 4 (6%) | 2 (4%) | 2 (14%) | .181 |
Pulmonary disease | ||||
Malignancy | 4 (6%) | 3 (5%) | 1 (7%) | .605 |
Asthma | 2 (3%) | 2 (4%) | 0 | .633 |
Chronic hepatitis | 1 (1%) | 1 (2%) | 0 | .797 |
Fever at onset of illness | 60 (87%) | 47 (85%) | 13 (93%) | .674 |
Highest temperature, °C | 38.5 (38.0–38.8) | 38.5 (38.0–38.8) | 38.3 (38.0–38.8) | .525 |
<37.3 | 9 (13%) | 8 (15%) | 1 (7%) | .579 |
37.3–38 | 7 (10%) | 5 (9%) | 2 (14%) | |
38.1–39 | 40 (58%) | 31 (56%) | 9 (64%) | |
>39 | 13 (19%) | 11 (20%) | 2 (14%) | |
Fever on day 10 from onset of illness | 30 (43%) | 21 (38%) | 9 (64%) | .079 |
Temperature, °C | 37.1 (36.8–38.0) | 37.5 (37.2–38.1) | 37.0 (36.7–38.0) | .038 |
<37.3 | 39 (57%) | 34 (62%) | 5 (36%) | .296 |
37.3–38 | 13 (19%) | 9 (16%) | 4 (29%) | |
38.1–39 | 15 (22%) | 11 (20%) | 4 (29%) | |
>39 | 2 (3%) | 1 (2%) | 1 (7%) | |
Symptoms at onset of illness | ||||
Cough | 38 (55%) | 30 (55%) | 8 (57%) | .553 |
Fatigue | 29 (42%) | 22 (40%) | 7 (50%) | .499 |
Myalgia | 21 (30%) | 19 (35%) | 2 (14%) | .124 |
Sputum production | 20 (29%) | 16 (29%) | 4 (29%) | .624 |
Dyspnea | 20 (29%) | 13 (24%) | 7 (50%) | .057 |
Oppression in chest | 14 (20%) | 12 (22%) | 2 (14%) | .418 |
Diarrhea | 10 (14%) | 8 (15%) | 2 (14%) | .674 |
Headache | 10 (14%) | 10 (18%) | 0 | .086 |
Anorexia | 7 (10%) | 6 (11%) | 1 (7%) | .564 |
Chest pain | 6 (9%) | 4 (7%) | 2 (14%) | .352 |
Pharyngalgia | 6 (9%) | 5 (9%) | 1 (7%) | .648 |
Dizziness | 5 (7%) | 4 (7%) | 1 (7%) | .734 |
Palpitation | 5 (7%) | 4 (7%) | 1 (7%) | .734 |
Vomiting | 3 (4%) | 2 (4%) | 1 (7%) | .499 |
. | All Patients (N = 69) . | SpO2 ≥ 90% (n = 55) . | SpO2 < 90% (n = 14) . | P Value . |
---|---|---|---|---|
Age (y) | 42.0 (35.0–62.0) | 37.0 (32.0–51.0) | 70.5 (62.0–77.0) | <.001 |
Sex | ||||
Male | 32 (46%) | 25 (45%) | 7 (50%) | .761 |
Female | 37 (54%) | 30 (55%) | 7 (50%) | |
From admission to time of lowest SpO2 (d) | 2.0 (1.0–3.0) | 2.0 (1.0–3.0) | 1.0 (0–2.0) | .205 |
From onset to time of lowest SpO2 (d) | 8.0 (7.0–11.0) | 8.0 (6.0–11.0) | 8.5 (7.0–11.0) | .892 |
Comorbidity | ||||
Hypertension | 9 (13%) | 4 (7%) | 5 (36%) | .014 |
Cardiovascular disease | 8 (12%) | 3 (5%) | 5 (36%) | .007 |
Diabetes | 7 (10%) | 1 (2%) | 6 (43%) | <.001 |
Chronic obstructive | 4 (6%) | 2 (4%) | 2 (14%) | .181 |
Pulmonary disease | ||||
Malignancy | 4 (6%) | 3 (5%) | 1 (7%) | .605 |
Asthma | 2 (3%) | 2 (4%) | 0 | .633 |
Chronic hepatitis | 1 (1%) | 1 (2%) | 0 | .797 |
Fever at onset of illness | 60 (87%) | 47 (85%) | 13 (93%) | .674 |
Highest temperature, °C | 38.5 (38.0–38.8) | 38.5 (38.0–38.8) | 38.3 (38.0–38.8) | .525 |
<37.3 | 9 (13%) | 8 (15%) | 1 (7%) | .579 |
37.3–38 | 7 (10%) | 5 (9%) | 2 (14%) | |
38.1–39 | 40 (58%) | 31 (56%) | 9 (64%) | |
>39 | 13 (19%) | 11 (20%) | 2 (14%) | |
Fever on day 10 from onset of illness | 30 (43%) | 21 (38%) | 9 (64%) | .079 |
Temperature, °C | 37.1 (36.8–38.0) | 37.5 (37.2–38.1) | 37.0 (36.7–38.0) | .038 |
<37.3 | 39 (57%) | 34 (62%) | 5 (36%) | .296 |
37.3–38 | 13 (19%) | 9 (16%) | 4 (29%) | |
38.1–39 | 15 (22%) | 11 (20%) | 4 (29%) | |
>39 | 2 (3%) | 1 (2%) | 1 (7%) | |
Symptoms at onset of illness | ||||
Cough | 38 (55%) | 30 (55%) | 8 (57%) | .553 |
Fatigue | 29 (42%) | 22 (40%) | 7 (50%) | .499 |
Myalgia | 21 (30%) | 19 (35%) | 2 (14%) | .124 |
Sputum production | 20 (29%) | 16 (29%) | 4 (29%) | .624 |
Dyspnea | 20 (29%) | 13 (24%) | 7 (50%) | .057 |
Oppression in chest | 14 (20%) | 12 (22%) | 2 (14%) | .418 |
Diarrhea | 10 (14%) | 8 (15%) | 2 (14%) | .674 |
Headache | 10 (14%) | 10 (18%) | 0 | .086 |
Anorexia | 7 (10%) | 6 (11%) | 1 (7%) | .564 |
Chest pain | 6 (9%) | 4 (7%) | 2 (14%) | .352 |
Pharyngalgia | 6 (9%) | 5 (9%) | 1 (7%) | .648 |
Dizziness | 5 (7%) | 4 (7%) | 1 (7%) | .734 |
Palpitation | 5 (7%) | 4 (7%) | 1 (7%) | .734 |
Vomiting | 3 (4%) | 2 (4%) | 1 (7%) | .499 |
Data are median (IQR) or n/N (%), in which N is the total number of patients with available data. P values are comparing the SpO2 ≥ 90% group and the SpO2 < 90% group from Mann-Whitney U test, χ 2 test, or Fisher exact test. P < .05 was considered statistically significant.
Abbreviations: IQR, interquartile range; SARS-CoV-2, 2019 severe acute respiratory syndrome coronavirus 2; SpO2, saturation of peripheral oxygen.
The most common clinical feature at the onset of illness was fever (60 [87%]); 40 (58%) of them had a temperature that reached 38.1–39.0°C, and 13 (19%) of them had a temperature that exceeded 39.0°C. On day 10 from onset of illness, the cases of fever declined to 30 (43%), and 15 (22%) of them had a temperature within 38.1–39.0°C. Other common clinical manifestations included cough (38 [55%]), fatigue (29 [42%]), and myalgia (21 [33%]). Less common symptoms were sputum production, oppression in chest, dyspnea, diarrhea, headache, and so forth (Table 1). Compared with the SpO2 ≥ 90% group, patients of the SpO2 < 90% group tend to show more frequency of fever and dyspnea.
The blood counts of patients on admission showed decrease in neutrophils (26 [39%] of 67 patients), lymphocytes (28 [42%] of 67 patients), and eosinophils (48 [72%] of 67 patients), among which, the number of eosinophils in 31 patients was zero. Concurrently, patients of the SpO2 < 90% group showed more frequency of lymphopenia than those of the SpO2 ≥ 90% group (11 [79%] of 14 patients vs 17 [32%] of 53 patients, P = .002). The enrolled patients showed increase in alanine aminotransferase (23 [33%] of 69 patients) and aspartate aminotransferase (19 [28%] of 69 patients), most of which count <100 U/L. In terms of inflammation indicators, patients on admission showed increase in lactate dehydrogenase (25 [41%] of 61 patients), C reactive protein (42 [67%] of 63 patients), and erythrocyte sedimentation rate (30 [52%] of 58 patients), but not procalcitonin. The proportion and extent of the increase of lactate dehydrogenase, C reactive protein, and erythrocyte sedimentation rate are more prominent in the SpO2 < 90% group (Table 2).
. | All Patients (N = 69) . | SpO2 ≥ 90% (n = 55) . | SpO2 <90% (n = 14) . | P Value . |
---|---|---|---|---|
White blood cell count, ×109/L | 3.82 (2.98–5.57) | 3.57 (2.96–4.93) | 6.52 (4.30–7.73) | .006 |
<4 | 36/67 (54%) | 33/53 (62%) | 3/14 (21%) | .007 |
4–10 | 30/67 (45%) | 20/53 (38%) | 10/14 (71%) | |
>10 | 1/67 (1%) | 0/53 | 1/14 (7%) | |
Neutrophil count, ×109/L | 2.35 (1.62–367) | 2.16 (1.60–2.70) | 5.24 (2.90–6.44) | <.001 |
≤2 | 26/67 (39%) | 24/53 (45%) | 2/14 (14%) | .034 |
>2 | 41/67 (61%) | 29/53 (55%) | 12/14 (86%) | |
Lymphocyte count, ×109/L | 1.15 (0.82–1.46) | 1.19 (0.95–1.46) | 0.61 (0.37–1.00) | .002 |
<1.1 | 28/67 (42%) | 17/53 (32%) | 11/14 (79%) | .002 |
≥1.1 | 39/67 (58%) | 36/53 (68%) | 3/14 (21%) | |
Monocyte count, ×109/L | 0.31 (0.23–0.44) | 0.31 (0.24–0.46) | 0.27 (0.14–0.41) | .22 |
Eosinophil count, ×109/L | 0.01 (0.00–0.02) | 0.01 (0.00–0.02) | 0.00 (0.00–0.01) | .195 |
<0.02 | 48/67 (72%) | 37/53 (70%) | 11/14 (79%) | .518 |
≥0.02 | 19/67 (28%) | 16/53 (30%) | 3/14 (21%) | |
Hemoglobin, g/L | 130.00 (118.00–140.00) | 131.00 (121.00–141.00) | 128.00 (117.00–136.00) | .507 |
Platelet count, ×109/L | 171.00 (142.00–211.00) | 172.00 (138.00–206.00) | 167.00 (144.00–215.00) | .829 |
Alanine aminotransferase, U/L | 25.00 (17.00–40.00) | 24.00 (16.00–40.00) | 31.50 (23.00–52.00) | .119 |
≤35 | 46/69 (67%) | 38/55 (69%) | 8/14 (57%) | .527 |
>35 | 23/69 (33%) | 17/55 (31%) | 6/14 (43%) | |
Aspartate aminotransferase, U/L | 28.00 (22.00–42.00) | 26.00 (21.00–39.00) | 40.50 (24.00–62.00) | .03 |
≤40 | 50/69 (72%) | 43/55 (78%) | 7/14 (50%) | .048 |
>40 | 19/69 (28%) | 12/55 (22%) | 7/14 (50%) | |
Creatinine, μmol/L | 66.35 (58.00–79.65) | 65.30 (58.00–78.50) | 71.50 (52.50–80.40) | .623 |
Lactate dehydrogenase, U/L | 224.00 (183.00–291.00) | 207.00 (181.00–274.00) | 517.50 (267.00–549.00) | .001 |
≤245 | 36/61 (59%) | 34/49 (69%) | 2/12 (17%) | .002 |
>245 | 25/61 (41%) | 15/49 (31%) | 10/12 (83%) | |
C-reactive protein, mg/L | 13.20 (6.78–49.00) | 11.30 (6.53–26.30) | 81.55 (48.85–105.90) | <.001 |
<8 | 21/63 (33%) | 20/51 (39%) | 1/12 (8%) | <.001 |
8–50 | 28/63 (44%) | 26/51 (51%) | 2/12 (17%) | |
50–100 | 8/63 (13%) | 2/51 (4%) | 6/12 (50%) | |
≥100 | 6/63 (10%) | 3/51 (6%) | 3/12 (25%) | |
Procalcitonin, μg/L | 0.13 (0.13–0.15) | 0.13 (0.13–0.15) | 0.13 (0.13–0.15) | .78 |
<0.5 | 58/62 (94%) | 46/50 (92%) | 12/12 (100%) | .578 |
≥0.5 | 4/62 (6%) | 4/50 (8%) | 0/12 | |
Erythrocyte sedimentation rate, mm/h | 20.00 (8.00–31.00) | 17.00 (7.00–25.00) | 30.00 (27.00–49.00) | .001 |
<20 | 28/58 (48%) | 27/45 (60%) | 1/13 (8%) | .001 |
≥20 | 30/58 (52%) | 18/45 (40%) | 12/13 (92%) |
. | All Patients (N = 69) . | SpO2 ≥ 90% (n = 55) . | SpO2 <90% (n = 14) . | P Value . |
---|---|---|---|---|
White blood cell count, ×109/L | 3.82 (2.98–5.57) | 3.57 (2.96–4.93) | 6.52 (4.30–7.73) | .006 |
<4 | 36/67 (54%) | 33/53 (62%) | 3/14 (21%) | .007 |
4–10 | 30/67 (45%) | 20/53 (38%) | 10/14 (71%) | |
>10 | 1/67 (1%) | 0/53 | 1/14 (7%) | |
Neutrophil count, ×109/L | 2.35 (1.62–367) | 2.16 (1.60–2.70) | 5.24 (2.90–6.44) | <.001 |
≤2 | 26/67 (39%) | 24/53 (45%) | 2/14 (14%) | .034 |
>2 | 41/67 (61%) | 29/53 (55%) | 12/14 (86%) | |
Lymphocyte count, ×109/L | 1.15 (0.82–1.46) | 1.19 (0.95–1.46) | 0.61 (0.37–1.00) | .002 |
<1.1 | 28/67 (42%) | 17/53 (32%) | 11/14 (79%) | .002 |
≥1.1 | 39/67 (58%) | 36/53 (68%) | 3/14 (21%) | |
Monocyte count, ×109/L | 0.31 (0.23–0.44) | 0.31 (0.24–0.46) | 0.27 (0.14–0.41) | .22 |
Eosinophil count, ×109/L | 0.01 (0.00–0.02) | 0.01 (0.00–0.02) | 0.00 (0.00–0.01) | .195 |
<0.02 | 48/67 (72%) | 37/53 (70%) | 11/14 (79%) | .518 |
≥0.02 | 19/67 (28%) | 16/53 (30%) | 3/14 (21%) | |
Hemoglobin, g/L | 130.00 (118.00–140.00) | 131.00 (121.00–141.00) | 128.00 (117.00–136.00) | .507 |
Platelet count, ×109/L | 171.00 (142.00–211.00) | 172.00 (138.00–206.00) | 167.00 (144.00–215.00) | .829 |
Alanine aminotransferase, U/L | 25.00 (17.00–40.00) | 24.00 (16.00–40.00) | 31.50 (23.00–52.00) | .119 |
≤35 | 46/69 (67%) | 38/55 (69%) | 8/14 (57%) | .527 |
>35 | 23/69 (33%) | 17/55 (31%) | 6/14 (43%) | |
Aspartate aminotransferase, U/L | 28.00 (22.00–42.00) | 26.00 (21.00–39.00) | 40.50 (24.00–62.00) | .03 |
≤40 | 50/69 (72%) | 43/55 (78%) | 7/14 (50%) | .048 |
>40 | 19/69 (28%) | 12/55 (22%) | 7/14 (50%) | |
Creatinine, μmol/L | 66.35 (58.00–79.65) | 65.30 (58.00–78.50) | 71.50 (52.50–80.40) | .623 |
Lactate dehydrogenase, U/L | 224.00 (183.00–291.00) | 207.00 (181.00–274.00) | 517.50 (267.00–549.00) | .001 |
≤245 | 36/61 (59%) | 34/49 (69%) | 2/12 (17%) | .002 |
>245 | 25/61 (41%) | 15/49 (31%) | 10/12 (83%) | |
C-reactive protein, mg/L | 13.20 (6.78–49.00) | 11.30 (6.53–26.30) | 81.55 (48.85–105.90) | <.001 |
<8 | 21/63 (33%) | 20/51 (39%) | 1/12 (8%) | <.001 |
8–50 | 28/63 (44%) | 26/51 (51%) | 2/12 (17%) | |
50–100 | 8/63 (13%) | 2/51 (4%) | 6/12 (50%) | |
≥100 | 6/63 (10%) | 3/51 (6%) | 3/12 (25%) | |
Procalcitonin, μg/L | 0.13 (0.13–0.15) | 0.13 (0.13–0.15) | 0.13 (0.13–0.15) | .78 |
<0.5 | 58/62 (94%) | 46/50 (92%) | 12/12 (100%) | .578 |
≥0.5 | 4/62 (6%) | 4/50 (8%) | 0/12 | |
Erythrocyte sedimentation rate, mm/h | 20.00 (8.00–31.00) | 17.00 (7.00–25.00) | 30.00 (27.00–49.00) | .001 |
<20 | 28/58 (48%) | 27/45 (60%) | 1/13 (8%) | .001 |
≥20 | 30/58 (52%) | 18/45 (40%) | 12/13 (92%) |
Data are median (IQR) or n/N (%), in which N is the total number of patients with available data. P values are comparing the SpO2 ≥ 90% group and the SpO2 < 90% group from Mann-Whitney U test, χ 2 test, or Fisher exact test. P < .05 was considered statistically significant.
Abbreviations: IQR, interquartile range; SARS-CoV-2, 2019 severe acute respiratory syndrome coronavirus 2; SpO2, saturation of peripheral oxygen.
. | All Patients (N = 69) . | SpO2 ≥ 90% (n = 55) . | SpO2 <90% (n = 14) . | P Value . |
---|---|---|---|---|
White blood cell count, ×109/L | 3.82 (2.98–5.57) | 3.57 (2.96–4.93) | 6.52 (4.30–7.73) | .006 |
<4 | 36/67 (54%) | 33/53 (62%) | 3/14 (21%) | .007 |
4–10 | 30/67 (45%) | 20/53 (38%) | 10/14 (71%) | |
>10 | 1/67 (1%) | 0/53 | 1/14 (7%) | |
Neutrophil count, ×109/L | 2.35 (1.62–367) | 2.16 (1.60–2.70) | 5.24 (2.90–6.44) | <.001 |
≤2 | 26/67 (39%) | 24/53 (45%) | 2/14 (14%) | .034 |
>2 | 41/67 (61%) | 29/53 (55%) | 12/14 (86%) | |
Lymphocyte count, ×109/L | 1.15 (0.82–1.46) | 1.19 (0.95–1.46) | 0.61 (0.37–1.00) | .002 |
<1.1 | 28/67 (42%) | 17/53 (32%) | 11/14 (79%) | .002 |
≥1.1 | 39/67 (58%) | 36/53 (68%) | 3/14 (21%) | |
Monocyte count, ×109/L | 0.31 (0.23–0.44) | 0.31 (0.24–0.46) | 0.27 (0.14–0.41) | .22 |
Eosinophil count, ×109/L | 0.01 (0.00–0.02) | 0.01 (0.00–0.02) | 0.00 (0.00–0.01) | .195 |
<0.02 | 48/67 (72%) | 37/53 (70%) | 11/14 (79%) | .518 |
≥0.02 | 19/67 (28%) | 16/53 (30%) | 3/14 (21%) | |
Hemoglobin, g/L | 130.00 (118.00–140.00) | 131.00 (121.00–141.00) | 128.00 (117.00–136.00) | .507 |
Platelet count, ×109/L | 171.00 (142.00–211.00) | 172.00 (138.00–206.00) | 167.00 (144.00–215.00) | .829 |
Alanine aminotransferase, U/L | 25.00 (17.00–40.00) | 24.00 (16.00–40.00) | 31.50 (23.00–52.00) | .119 |
≤35 | 46/69 (67%) | 38/55 (69%) | 8/14 (57%) | .527 |
>35 | 23/69 (33%) | 17/55 (31%) | 6/14 (43%) | |
Aspartate aminotransferase, U/L | 28.00 (22.00–42.00) | 26.00 (21.00–39.00) | 40.50 (24.00–62.00) | .03 |
≤40 | 50/69 (72%) | 43/55 (78%) | 7/14 (50%) | .048 |
>40 | 19/69 (28%) | 12/55 (22%) | 7/14 (50%) | |
Creatinine, μmol/L | 66.35 (58.00–79.65) | 65.30 (58.00–78.50) | 71.50 (52.50–80.40) | .623 |
Lactate dehydrogenase, U/L | 224.00 (183.00–291.00) | 207.00 (181.00–274.00) | 517.50 (267.00–549.00) | .001 |
≤245 | 36/61 (59%) | 34/49 (69%) | 2/12 (17%) | .002 |
>245 | 25/61 (41%) | 15/49 (31%) | 10/12 (83%) | |
C-reactive protein, mg/L | 13.20 (6.78–49.00) | 11.30 (6.53–26.30) | 81.55 (48.85–105.90) | <.001 |
<8 | 21/63 (33%) | 20/51 (39%) | 1/12 (8%) | <.001 |
8–50 | 28/63 (44%) | 26/51 (51%) | 2/12 (17%) | |
50–100 | 8/63 (13%) | 2/51 (4%) | 6/12 (50%) | |
≥100 | 6/63 (10%) | 3/51 (6%) | 3/12 (25%) | |
Procalcitonin, μg/L | 0.13 (0.13–0.15) | 0.13 (0.13–0.15) | 0.13 (0.13–0.15) | .78 |
<0.5 | 58/62 (94%) | 46/50 (92%) | 12/12 (100%) | .578 |
≥0.5 | 4/62 (6%) | 4/50 (8%) | 0/12 | |
Erythrocyte sedimentation rate, mm/h | 20.00 (8.00–31.00) | 17.00 (7.00–25.00) | 30.00 (27.00–49.00) | .001 |
<20 | 28/58 (48%) | 27/45 (60%) | 1/13 (8%) | .001 |
≥20 | 30/58 (52%) | 18/45 (40%) | 12/13 (92%) |
. | All Patients (N = 69) . | SpO2 ≥ 90% (n = 55) . | SpO2 <90% (n = 14) . | P Value . |
---|---|---|---|---|
White blood cell count, ×109/L | 3.82 (2.98–5.57) | 3.57 (2.96–4.93) | 6.52 (4.30–7.73) | .006 |
<4 | 36/67 (54%) | 33/53 (62%) | 3/14 (21%) | .007 |
4–10 | 30/67 (45%) | 20/53 (38%) | 10/14 (71%) | |
>10 | 1/67 (1%) | 0/53 | 1/14 (7%) | |
Neutrophil count, ×109/L | 2.35 (1.62–367) | 2.16 (1.60–2.70) | 5.24 (2.90–6.44) | <.001 |
≤2 | 26/67 (39%) | 24/53 (45%) | 2/14 (14%) | .034 |
>2 | 41/67 (61%) | 29/53 (55%) | 12/14 (86%) | |
Lymphocyte count, ×109/L | 1.15 (0.82–1.46) | 1.19 (0.95–1.46) | 0.61 (0.37–1.00) | .002 |
<1.1 | 28/67 (42%) | 17/53 (32%) | 11/14 (79%) | .002 |
≥1.1 | 39/67 (58%) | 36/53 (68%) | 3/14 (21%) | |
Monocyte count, ×109/L | 0.31 (0.23–0.44) | 0.31 (0.24–0.46) | 0.27 (0.14–0.41) | .22 |
Eosinophil count, ×109/L | 0.01 (0.00–0.02) | 0.01 (0.00–0.02) | 0.00 (0.00–0.01) | .195 |
<0.02 | 48/67 (72%) | 37/53 (70%) | 11/14 (79%) | .518 |
≥0.02 | 19/67 (28%) | 16/53 (30%) | 3/14 (21%) | |
Hemoglobin, g/L | 130.00 (118.00–140.00) | 131.00 (121.00–141.00) | 128.00 (117.00–136.00) | .507 |
Platelet count, ×109/L | 171.00 (142.00–211.00) | 172.00 (138.00–206.00) | 167.00 (144.00–215.00) | .829 |
Alanine aminotransferase, U/L | 25.00 (17.00–40.00) | 24.00 (16.00–40.00) | 31.50 (23.00–52.00) | .119 |
≤35 | 46/69 (67%) | 38/55 (69%) | 8/14 (57%) | .527 |
>35 | 23/69 (33%) | 17/55 (31%) | 6/14 (43%) | |
Aspartate aminotransferase, U/L | 28.00 (22.00–42.00) | 26.00 (21.00–39.00) | 40.50 (24.00–62.00) | .03 |
≤40 | 50/69 (72%) | 43/55 (78%) | 7/14 (50%) | .048 |
>40 | 19/69 (28%) | 12/55 (22%) | 7/14 (50%) | |
Creatinine, μmol/L | 66.35 (58.00–79.65) | 65.30 (58.00–78.50) | 71.50 (52.50–80.40) | .623 |
Lactate dehydrogenase, U/L | 224.00 (183.00–291.00) | 207.00 (181.00–274.00) | 517.50 (267.00–549.00) | .001 |
≤245 | 36/61 (59%) | 34/49 (69%) | 2/12 (17%) | .002 |
>245 | 25/61 (41%) | 15/49 (31%) | 10/12 (83%) | |
C-reactive protein, mg/L | 13.20 (6.78–49.00) | 11.30 (6.53–26.30) | 81.55 (48.85–105.90) | <.001 |
<8 | 21/63 (33%) | 20/51 (39%) | 1/12 (8%) | <.001 |
8–50 | 28/63 (44%) | 26/51 (51%) | 2/12 (17%) | |
50–100 | 8/63 (13%) | 2/51 (4%) | 6/12 (50%) | |
≥100 | 6/63 (10%) | 3/51 (6%) | 3/12 (25%) | |
Procalcitonin, μg/L | 0.13 (0.13–0.15) | 0.13 (0.13–0.15) | 0.13 (0.13–0.15) | .78 |
<0.5 | 58/62 (94%) | 46/50 (92%) | 12/12 (100%) | .578 |
≥0.5 | 4/62 (6%) | 4/50 (8%) | 0/12 | |
Erythrocyte sedimentation rate, mm/h | 20.00 (8.00–31.00) | 17.00 (7.00–25.00) | 30.00 (27.00–49.00) | .001 |
<20 | 28/58 (48%) | 27/45 (60%) | 1/13 (8%) | .001 |
≥20 | 30/58 (52%) | 18/45 (40%) | 12/13 (92%) |
Data are median (IQR) or n/N (%), in which N is the total number of patients with available data. P values are comparing the SpO2 ≥ 90% group and the SpO2 < 90% group from Mann-Whitney U test, χ 2 test, or Fisher exact test. P < .05 was considered statistically significant.
Abbreviations: IQR, interquartile range; SARS-CoV-2, 2019 severe acute respiratory syndrome coronavirus 2; SpO2, saturation of peripheral oxygen.
At the time of admission, all of the 69 patients had abnormal chest CT findings. Figure 2 shows a typical evolution of chest CT of COVID-19, which belongs to a 74-year-old female. As shown in Figure 2A, the most common CT manifestation on admission is ground glass density enhancement along the outer bands of both lungs. Several days later, the ground glass opacity began to solidify, as shown in Figure 2B. With the development of disease, the consolidation absorbed gradually, as shown in Figure 2C and 2D. In general, the reabsorption takes much longer than consolidation. Figure 3 showed chest CT images of 4 patients, A/B in the SpO2 ≥ 90% group and C/D in the SpO2 < 90% group. The opacity area of the ground glass is larger and the consolidation degree is more serious in the SpO2 < 90% group.
Plasma proportion of CD4-positive T lymphocytes, CD8-positive T lymphocytes, and B lymphocytes in patients with COVID-19 was within the normal range. The interleukin (IL) 6 and IL10 levels in plasma exceeded the upper limit of normal value in both the SpO2 ≥ 90% group and the SpO2 < 90% group. Notably, the level of IL6 in 7 (100%) of 7 patients in the SpO2 < 90% group exceeded 20 pg/mL (Table 3).
. | All Patients (N = 43) . | SpO2 ≥ 90% (n = 36) . | SpO2 < 90% (n = 7) . | P Value . |
---|---|---|---|---|
CD4-positive T lymphocytes (%) | 38.19 (32.14–43.5) | 38.25 (31.98–43.15) | 37.90 (32.82–54.21) | .508 |
CD8-positive T lymphocytes (%) | 26.00 (20.62–30.03) | 27.51 (21.12–30.10) | 22.86 (18.64–25.08) | .12 |
B lymphocytes (%) | 11.43 (7.54–14.63) | 11.02 (7.46–14.37) | 12.68 (8.30–23.00) | .488 |
IL-2, pg/mL | 2.63 (2.43–2.77) | 2.63 (2.43–2.77) | 2.77 (2.43–3.32) | .156 |
IL-4, pg/mL | 2.00 (1.81–2.26) | 1.95 (1.76–2.21) | 2.26 (1.95–2.31) | .137 |
IL-6, pg/mL | 8.54 (4.68–20.58) | 6.69 (4.44–12.43) | 51.69 (34.31–161.65) | <.001 |
<3 | 3/43 (7%) | 3/36 (8%) | 0/7 | <.001 |
3–20 | 29/43 (67%) | 29/36 (81%) | 0/7 | |
≥20 | 11/43 (26%) | 4/36 (11%) | 7/7 (100%) | |
IL-10, pg/mL | 4.23 (3.43–5.45) | 4.18 (3.31–5.275) | 6.92 (4.21–11.53) | .013 |
<5 | 27/43 (63%) | 25/36 (69%) | 2/7 (29%) | .041 |
≥5 | 16/43 (37%) | 11/36 (31%) | 5/7 (71%) | |
TNFα, pg/mL | 2.08 (1.93–2.34) | 2.08 (1.93–2.35) | 2.14 (1.90–2.34) | .86 |
TNFγ, pg/mL | 2.19 (1.88–2.78) | 2.19 (1.91–2.72) | 2.23 (1.84–9.53) | .392 |
. | All Patients (N = 43) . | SpO2 ≥ 90% (n = 36) . | SpO2 < 90% (n = 7) . | P Value . |
---|---|---|---|---|
CD4-positive T lymphocytes (%) | 38.19 (32.14–43.5) | 38.25 (31.98–43.15) | 37.90 (32.82–54.21) | .508 |
CD8-positive T lymphocytes (%) | 26.00 (20.62–30.03) | 27.51 (21.12–30.10) | 22.86 (18.64–25.08) | .12 |
B lymphocytes (%) | 11.43 (7.54–14.63) | 11.02 (7.46–14.37) | 12.68 (8.30–23.00) | .488 |
IL-2, pg/mL | 2.63 (2.43–2.77) | 2.63 (2.43–2.77) | 2.77 (2.43–3.32) | .156 |
IL-4, pg/mL | 2.00 (1.81–2.26) | 1.95 (1.76–2.21) | 2.26 (1.95–2.31) | .137 |
IL-6, pg/mL | 8.54 (4.68–20.58) | 6.69 (4.44–12.43) | 51.69 (34.31–161.65) | <.001 |
<3 | 3/43 (7%) | 3/36 (8%) | 0/7 | <.001 |
3–20 | 29/43 (67%) | 29/36 (81%) | 0/7 | |
≥20 | 11/43 (26%) | 4/36 (11%) | 7/7 (100%) | |
IL-10, pg/mL | 4.23 (3.43–5.45) | 4.18 (3.31–5.275) | 6.92 (4.21–11.53) | .013 |
<5 | 27/43 (63%) | 25/36 (69%) | 2/7 (29%) | .041 |
≥5 | 16/43 (37%) | 11/36 (31%) | 5/7 (71%) | |
TNFα, pg/mL | 2.08 (1.93–2.34) | 2.08 (1.93–2.35) | 2.14 (1.90–2.34) | .86 |
TNFγ, pg/mL | 2.19 (1.88–2.78) | 2.19 (1.91–2.72) | 2.23 (1.84–9.53) | .392 |
Data are median (IQR) or n/N (%), in which N is the total number of patients with available data. P values are comparing the SpO2 ≥ 90% group and the SpO2 < 90% group from Mann-Whitney U test, χ 2 test, or Fisher exact test. P < .05 was considered statistically significant.
Abbreviations: IL, interleukin; IQR, interquartile range; SARS-CoV-2, 2019 severe acute respiratory syndrome coronavirus 2; SpO2, saturation of peripheral oxygen; TNF, tumor necrosis factor.
. | All Patients (N = 43) . | SpO2 ≥ 90% (n = 36) . | SpO2 < 90% (n = 7) . | P Value . |
---|---|---|---|---|
CD4-positive T lymphocytes (%) | 38.19 (32.14–43.5) | 38.25 (31.98–43.15) | 37.90 (32.82–54.21) | .508 |
CD8-positive T lymphocytes (%) | 26.00 (20.62–30.03) | 27.51 (21.12–30.10) | 22.86 (18.64–25.08) | .12 |
B lymphocytes (%) | 11.43 (7.54–14.63) | 11.02 (7.46–14.37) | 12.68 (8.30–23.00) | .488 |
IL-2, pg/mL | 2.63 (2.43–2.77) | 2.63 (2.43–2.77) | 2.77 (2.43–3.32) | .156 |
IL-4, pg/mL | 2.00 (1.81–2.26) | 1.95 (1.76–2.21) | 2.26 (1.95–2.31) | .137 |
IL-6, pg/mL | 8.54 (4.68–20.58) | 6.69 (4.44–12.43) | 51.69 (34.31–161.65) | <.001 |
<3 | 3/43 (7%) | 3/36 (8%) | 0/7 | <.001 |
3–20 | 29/43 (67%) | 29/36 (81%) | 0/7 | |
≥20 | 11/43 (26%) | 4/36 (11%) | 7/7 (100%) | |
IL-10, pg/mL | 4.23 (3.43–5.45) | 4.18 (3.31–5.275) | 6.92 (4.21–11.53) | .013 |
<5 | 27/43 (63%) | 25/36 (69%) | 2/7 (29%) | .041 |
≥5 | 16/43 (37%) | 11/36 (31%) | 5/7 (71%) | |
TNFα, pg/mL | 2.08 (1.93–2.34) | 2.08 (1.93–2.35) | 2.14 (1.90–2.34) | .86 |
TNFγ, pg/mL | 2.19 (1.88–2.78) | 2.19 (1.91–2.72) | 2.23 (1.84–9.53) | .392 |
. | All Patients (N = 43) . | SpO2 ≥ 90% (n = 36) . | SpO2 < 90% (n = 7) . | P Value . |
---|---|---|---|---|
CD4-positive T lymphocytes (%) | 38.19 (32.14–43.5) | 38.25 (31.98–43.15) | 37.90 (32.82–54.21) | .508 |
CD8-positive T lymphocytes (%) | 26.00 (20.62–30.03) | 27.51 (21.12–30.10) | 22.86 (18.64–25.08) | .12 |
B lymphocytes (%) | 11.43 (7.54–14.63) | 11.02 (7.46–14.37) | 12.68 (8.30–23.00) | .488 |
IL-2, pg/mL | 2.63 (2.43–2.77) | 2.63 (2.43–2.77) | 2.77 (2.43–3.32) | .156 |
IL-4, pg/mL | 2.00 (1.81–2.26) | 1.95 (1.76–2.21) | 2.26 (1.95–2.31) | .137 |
IL-6, pg/mL | 8.54 (4.68–20.58) | 6.69 (4.44–12.43) | 51.69 (34.31–161.65) | <.001 |
<3 | 3/43 (7%) | 3/36 (8%) | 0/7 | <.001 |
3–20 | 29/43 (67%) | 29/36 (81%) | 0/7 | |
≥20 | 11/43 (26%) | 4/36 (11%) | 7/7 (100%) | |
IL-10, pg/mL | 4.23 (3.43–5.45) | 4.18 (3.31–5.275) | 6.92 (4.21–11.53) | .013 |
<5 | 27/43 (63%) | 25/36 (69%) | 2/7 (29%) | .041 |
≥5 | 16/43 (37%) | 11/36 (31%) | 5/7 (71%) | |
TNFα, pg/mL | 2.08 (1.93–2.34) | 2.08 (1.93–2.35) | 2.14 (1.90–2.34) | .86 |
TNFγ, pg/mL | 2.19 (1.88–2.78) | 2.19 (1.91–2.72) | 2.23 (1.84–9.53) | .392 |
Data are median (IQR) or n/N (%), in which N is the total number of patients with available data. P values are comparing the SpO2 ≥ 90% group and the SpO2 < 90% group from Mann-Whitney U test, χ 2 test, or Fisher exact test. P < .05 was considered statistically significant.
Abbreviations: IL, interleukin; IQR, interquartile range; SARS-CoV-2, 2019 severe acute respiratory syndrome coronavirus 2; SpO2, saturation of peripheral oxygen; TNF, tumor necrosis factor.
The outcomes of 2 cases with hemopathy were lost because they were transferred to an infection specialized hospital and out of contact. So they were not enrolled in the analysis of treatment and prognosis in Table 4. The median time from onset of symptoms to admission was 6.0 days (IQR, 4.0–9.0). The majority of patients needed oxygen support (43 [64.2%] in 67 patients). Most patients received antiviral therapy (66 [98.5%] of 67 patients) and antibiotic therapy (66 [98.5%] of 67 patients). Meanwhile, the use of antifungal drugs (8 [11.9%] of 67 patients) and corticosteroids (10 [14.9%] of 67 patients) was limited. Most antibiotics and antiviral therapy were empiric.; 57 (85%) patients received interferon therapy, and 39 (58%) patients received moxifoxacin treatment. And 29 (43%) patients were examined for sputum culture, and 5 were positive, including 2 cases of Candida albicans, 2 cases of Enterobacter cloacae, and 1 case of Acinetobacter baumannii. In sum, 28 (42%) patients were tested for respiratory pathogen antibody with blood samples, and 4 were positive, including 2 cases of chlamydia immunoglobulin G (IgG), 1 case of syncytial virus immunoglobulin M (IgM), and 1 case of adenovirus IgM. No immunosuppressive therapies were used during the anti-infection course.
. | All Patients (N = 67) . | SpO2 ≥ 90% (n = 55) . | SpO2 < 90% (n = 12) . | P Value . |
---|---|---|---|---|
Onset of symptom to admission | 6.0 (4.0–9.0) | 6.0 (4.0–9.0) | 7.0 (4.0–9.0) | .928 |
Oxygen support | 43 (64.2%) | 31 (56.4%) | 12 (100.0%) | .003 |
Prognosis | ||||
Hospitalization | 44 (65.7%) | 38 (69.1%) | 6 (50.0%) | <.001 |
Discharge | 18 (26.9%) | 17 (30.9%) | 1 (8.3%) | |
Death | 5 (7.5%) | 0 | 5 (41.7%) | |
Involved treatment | ||||
Antiviral therapy | 66 (98.5%) | 55 (100.0%) | 11 (91.7%) | .179 |
Antibiotic therapy | 66 (98.5%) | 54 (98.2%) | 12 (100.0%) | .638 |
Antifungal therapy | 8 (11.9%) | 3 (5.5%) | 5 (41.7%) | <.001 |
Use of corticosteroids | 10 (14.9%) | 6 (10.9%) | 4 (33.3%) | .048 |
Arbidol | 36 (53.7%) | 32 (58.2%) | 4 (33.3%) | .118 |
. | All Patients (N = 67) . | SpO2 ≥ 90% (n = 55) . | SpO2 < 90% (n = 12) . | P Value . |
---|---|---|---|---|
Onset of symptom to admission | 6.0 (4.0–9.0) | 6.0 (4.0–9.0) | 7.0 (4.0–9.0) | .928 |
Oxygen support | 43 (64.2%) | 31 (56.4%) | 12 (100.0%) | .003 |
Prognosis | ||||
Hospitalization | 44 (65.7%) | 38 (69.1%) | 6 (50.0%) | <.001 |
Discharge | 18 (26.9%) | 17 (30.9%) | 1 (8.3%) | |
Death | 5 (7.5%) | 0 | 5 (41.7%) | |
Involved treatment | ||||
Antiviral therapy | 66 (98.5%) | 55 (100.0%) | 11 (91.7%) | .179 |
Antibiotic therapy | 66 (98.5%) | 54 (98.2%) | 12 (100.0%) | .638 |
Antifungal therapy | 8 (11.9%) | 3 (5.5%) | 5 (41.7%) | <.001 |
Use of corticosteroids | 10 (14.9%) | 6 (10.9%) | 4 (33.3%) | .048 |
Arbidol | 36 (53.7%) | 32 (58.2%) | 4 (33.3%) | .118 |
Data are median (IQR) or n/N (%), in which N is the total number of patients with available data. P values are comparing the SpO2 ≥ 90% group and the SpO2 < 90% group from Mann-Whitney U test, χ 2 test, or Fisher exact test. P < .05 was considered statistically significant.
Abbreviations: IQR, interquartile range; SARS-CoV-2, 2019 severe acute respiratory syndrome coronavirus 2; SpO2, saturation of peripheral oxygen.
. | All Patients (N = 67) . | SpO2 ≥ 90% (n = 55) . | SpO2 < 90% (n = 12) . | P Value . |
---|---|---|---|---|
Onset of symptom to admission | 6.0 (4.0–9.0) | 6.0 (4.0–9.0) | 7.0 (4.0–9.0) | .928 |
Oxygen support | 43 (64.2%) | 31 (56.4%) | 12 (100.0%) | .003 |
Prognosis | ||||
Hospitalization | 44 (65.7%) | 38 (69.1%) | 6 (50.0%) | <.001 |
Discharge | 18 (26.9%) | 17 (30.9%) | 1 (8.3%) | |
Death | 5 (7.5%) | 0 | 5 (41.7%) | |
Involved treatment | ||||
Antiviral therapy | 66 (98.5%) | 55 (100.0%) | 11 (91.7%) | .179 |
Antibiotic therapy | 66 (98.5%) | 54 (98.2%) | 12 (100.0%) | .638 |
Antifungal therapy | 8 (11.9%) | 3 (5.5%) | 5 (41.7%) | <.001 |
Use of corticosteroids | 10 (14.9%) | 6 (10.9%) | 4 (33.3%) | .048 |
Arbidol | 36 (53.7%) | 32 (58.2%) | 4 (33.3%) | .118 |
. | All Patients (N = 67) . | SpO2 ≥ 90% (n = 55) . | SpO2 < 90% (n = 12) . | P Value . |
---|---|---|---|---|
Onset of symptom to admission | 6.0 (4.0–9.0) | 6.0 (4.0–9.0) | 7.0 (4.0–9.0) | .928 |
Oxygen support | 43 (64.2%) | 31 (56.4%) | 12 (100.0%) | .003 |
Prognosis | ||||
Hospitalization | 44 (65.7%) | 38 (69.1%) | 6 (50.0%) | <.001 |
Discharge | 18 (26.9%) | 17 (30.9%) | 1 (8.3%) | |
Death | 5 (7.5%) | 0 | 5 (41.7%) | |
Involved treatment | ||||
Antiviral therapy | 66 (98.5%) | 55 (100.0%) | 11 (91.7%) | .179 |
Antibiotic therapy | 66 (98.5%) | 54 (98.2%) | 12 (100.0%) | .638 |
Antifungal therapy | 8 (11.9%) | 3 (5.5%) | 5 (41.7%) | <.001 |
Use of corticosteroids | 10 (14.9%) | 6 (10.9%) | 4 (33.3%) | .048 |
Arbidol | 36 (53.7%) | 32 (58.2%) | 4 (33.3%) | .118 |
Data are median (IQR) or n/N (%), in which N is the total number of patients with available data. P values are comparing the SpO2 ≥ 90% group and the SpO2 < 90% group from Mann-Whitney U test, χ 2 test, or Fisher exact test. P < .05 was considered statistically significant.
Abbreviations: IQR, interquartile range; SARS-CoV-2, 2019 severe acute respiratory syndrome coronavirus 2; SpO2, saturation of peripheral oxygen.
In a multicenter double-blind randomized placebo-controlled study, compared with the placebo, arbidol reduced the time to elimination of symptoms and abated the positive rate of influenza on day 4 (25 vs 53%, P < .05) [7]. Arbidol was licensed for upper respiratory tract infection caused by influenza A / B virus in China. In this work, 36 (53.7%) patients received treatment of arbidol from the beginning of hospitalization at of dose of 0.4 g for three times a day. The median duration of arbidol was 9 days. By the time of 4 February 2020, 18 (26.9%) of 67 patients had been discharged, and 5 patients had died, with a mortality rate of 7.5% in this cohort. The principle of discharge was based on relief of symptoms, obvious absorption of inflammation in chest CT, abatement of fever, and viral clearance with throat swabs for 2 consecutive times. Usually, RT-PCR assays would be carried out when the previous 3 conditions were met, and the time interval between 2 RT-PCR assays was at least 1 day. Furthermore, we evaluated the efficacy of arbidol. As a result, 12 (33%) of 36 patients had been discharged in the arbidol-treated group, whereas 6 (19%) of 31 patients had been discharged in the arbidol-untreated group. All deaths occurred in the arbidol-untreated group. It appears that arbidol treatment could improve the discharging rate and decrease the mortality rate (Table 5). The efficiency of antifungal agent and corticosteroids were also analyzed in Supplementary Tables 1 and 2. Antifungal agent did not show influence on the outcome of COVID-19 patients. And use of corticosteroids were associated with a higher risk of death.
Prognosis . | Arbidol-Treated Group (n = 36) . | Arbidol-Untreated Group (n = 31) . | P Value . |
---|---|---|---|
Hospitalization | 24 (67%) | 20 (65%) | .03 |
Discharge | 12 (33%) | 6 (19%) | |
Death | 0 | 5 (16%) |
Prognosis . | Arbidol-Treated Group (n = 36) . | Arbidol-Untreated Group (n = 31) . | P Value . |
---|---|---|---|
Hospitalization | 24 (67%) | 20 (65%) | .03 |
Discharge | 12 (33%) | 6 (19%) | |
Death | 0 | 5 (16%) |
Data are n/N (%), in which N is the total number of patients with available data. P values are comparing the arbidol-treated group and the arbidol-untreated group from χ 2 test. P < .05 was considered statistically significant.
Abbreviation: COVID-19, coronavirus disease 2019.
Prognosis . | Arbidol-Treated Group (n = 36) . | Arbidol-Untreated Group (n = 31) . | P Value . |
---|---|---|---|
Hospitalization | 24 (67%) | 20 (65%) | .03 |
Discharge | 12 (33%) | 6 (19%) | |
Death | 0 | 5 (16%) |
Prognosis . | Arbidol-Treated Group (n = 36) . | Arbidol-Untreated Group (n = 31) . | P Value . |
---|---|---|---|
Hospitalization | 24 (67%) | 20 (65%) | .03 |
Discharge | 12 (33%) | 6 (19%) | |
Death | 0 | 5 (16%) |
Data are n/N (%), in which N is the total number of patients with available data. P values are comparing the arbidol-treated group and the arbidol-untreated group from χ 2 test. P < .05 was considered statistically significant.
Abbreviation: COVID-19, coronavirus disease 2019.
DISCUSSION
Our experience with these 69 patients confirms that COVID-19 is a kind of epidemic pneumonia with fever, dry cough, and fatigue as the most common onset symptoms. Most patients have mild manifestations and excellent prognosis. The elderly and the patients with underlying comorbidities are prone to develop severe condition.
From the existing data, human-to-human transmission of SARS-CoV-2 among close contacts has occurred since the middle of December and spread out gradually within a month after that [8]. Although Wuhan, origin of the epidemic, had been blocked since 23 January 2020, the number of patients infected with SARS-CoV-2 still raised rapidly. Based on the imported cases from Wuhan into other cities, the basic reproductive number for SARS-CoV-2 was 2.68. The epidemic doubling time was estimated to be 6.4 days [9]. The Chinese government has taken various measures to control population flow and prevent cross-infection. But considering the imbalance between the large number of infected patients and limited medical resources in Wuhan, family clustering cases should be worried [10].
There is a certain degree of similarity between 2019-CoV and SARS-CoV. Both of them caused frequent fever, cough, and fatigue, whereas the upper respiratory symptoms like pharyngalgia and rhinorrhea were less common [11, 12]. SARS-CoV targets human angiotensin-converting enzyme 2 (hACE2) and infects intrapulmonary epithelial cells more than cells of the upper airways [13, 14]. MERS-CoV attaches to its receptor an exopeptidase called dipeptidyl peptidase 4 to infect its host [15]. It appears that SARS-CoV-2 uses the same cellular receptor as SARS-CoV did [16], so the replication of SARS-CoV-2 is more likely to happen in the lower respiratory tract rather than the throat. This hypothesis may be the reason for the false negative results of throat swab specimens for RT-PCR assays of SARS-CoV-2. But whether efficient transmission of SARS-CoV-2 will only occur after signs of lower respiratory tract disease develop is still to be elucidated. SARS-CoV was able to infect multiple cell types in several organs, including circulating lymphocytes, the epithelial cells of the respiratory tract, and the mucosa of the intestine [17]. To be noticed, SARS-CoV-2 caused diarrhea in this cohort, which was also reported in 2 other researches [5, 18]. Given that SARS-CoV-2 and SARS-CoV share 75%–80% gene sequence, and the genomic sequence was detected in the feces of patients infected with SARS-CoV-2, it is likely that SARS-CoV-2 would infect more than just the respiratory system, which may complicate the treatment and prophylaxis of COVID-19 [16].
Consistent with SARS-CoV [19, 20] and MERS-CoV [21, 22], SARS-CoV-2 induced high level of cytokines in plasma. Evidence from SARS and MERS indicates that receiving corticosteroids did not improve mortality but rather delayed viral clearance [23, 24]. In this cohort, only 10 (14.9%) of 67 patients received corticosteroid treatment. The other 2 hospitals in Wuhan that reported utilization rates of corticosteroids were 22% and 44.9%, respectively [3, 5]. In fact, as far as we know, doctors in Wuhan are generally very cautious in using corticosteroids when treating COVID-19. According to published data from the Chinese government, the mortality rate of COVID-19 was 4.1% for Wuhan and 2.0% for the whole mainland of China, which were much lower than that of SARS and MERS, indicating the limited using of corticosteroids was reasonable. Because of the limited sample in this work, the correlation between use of corticosteroids and death should be interpreted with caution. Currently, COVID-19 has no particularly effective treatment. The effect of antiviral therapy is still controversial [25]. Here we tried to treat COVID-19 patients with arbidol. The mechanism of arbidol, a small indole-derivative molecule, involves inhibition of virus-mediated fusion with target membrane and a resulting block of virus entry into target cells [26, 27]. In this cohort, arbidol showed tendency to improve discharging rate and reduce mortality. Due to the limited sample size of this study, this tendency should be verified with a randomized controlled trial to assess the efficacy and safety of arbidol in patients infected with SARS-CoV-2 before it works for guiding treatment.
According to the guideline for management of COVID-19 from the national health commission of China [28], 2 consecutive times of negative nucleic acid tests of respiratory samples are needed before discharge. And the sampling time should be at least 24 hours apart. But some patients still showed positive RT-PCR tests with SARS-CoV-2 after discharge [29]. Therefore, apart from the 2 times of negative tests for discharge, additional RT-PCR tests may be needed for some patients depending on viral burden, timing during the course of infection, and the sensitivity of the assays being used. After charge, patients are strongly suggested to be quarantined for monitoring health condition for 2 weeks.
As the size of this cohort is limited, the statistical analysis results should be interpreted with caution, and the P value without statistical significance does not necessarily reflect the exact situation of the whole population. Larger sample size of clinical studies is needed to elucidate the epidemiology, clinical characteristics and prognostic factors of COVID-19. Moreover, due to the outcomes data of 2 patients in the SpO2 < 90% group was missing, the prognosis comparation between the SpO2 < 90% group and the SpO2 ≥ 90% group may be biased.
COVID-19 is becoming a global health threat. Finding the source of infection and studying the behavior of SARS-CoV-2 are crucial for understanding this epidemic. Although there are some false negatives, throat swab sampling for RT-PCR detection has been widely used in the screening of suspected patient. CT examination of the chest also provides great help in diagnosis and evaluation of the curative effect. Early diagnosis, timely isolation, and appropriate treatment are the keys in fighting this infection.
Supplementary Data
Supplementary materials are available at Clinical Infectious Diseases online. Consisting of data provided by the authors to benefit the reader, the posted materials are not copyedited and are the sole responsibility of the authors, so questions or comments should be addressed to the corresponding author.
Note
Potential conflicts of interest. The authors: No reported conflicts of interest. All authors have submitted the ICMJE Form for Disclosure of Potential Conflicts of Interest.
Comments